ID: 1132451172

View in Genome Browser
Species Human (GRCh38)
Location 15:101969333-101969355
Sequence TTGTGTCCCCACGGTGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132451158_1132451172 30 Left 1132451158 15:101969280-101969302 CCTGTGGGCCAGGCCTCTTTGAA No data
Right 1132451172 15:101969333-101969355 TTGTGTCCCCACGGTGCCACGGG No data
1132451162_1132451172 22 Left 1132451162 15:101969288-101969310 CCAGGCCTCTTTGAATGGGGCTG No data
Right 1132451172 15:101969333-101969355 TTGTGTCCCCACGGTGCCACGGG No data
1132451165_1132451172 17 Left 1132451165 15:101969293-101969315 CCTCTTTGAATGGGGCTGAGGGA No data
Right 1132451172 15:101969333-101969355 TTGTGTCCCCACGGTGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132451172 Original CRISPR TTGTGTCCCCACGGTGCCAC GGG Intergenic
No off target data available for this crispr