ID: 1132453823

View in Genome Browser
Species Human (GRCh38)
Location 16:11722-11744
Sequence CCAGTGCTCAGCTTGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132453823_1132453831 22 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453831 16:11767-11789 GAGCCATGCCTAGAGTGGGATGG No data
1132453823_1132453826 -5 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453826 16:11740-11762 ACTGGAGTGGAGTTTTCCTGTGG No data
1132453823_1132453830 18 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453830 16:11763-11785 AGAGGAGCCATGCCTAGAGTGGG No data
1132453823_1132453829 17 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453829 16:11762-11784 GAGAGGAGCCATGCCTAGAGTGG No data
1132453823_1132453832 23 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453832 16:11768-11790 AGCCATGCCTAGAGTGGGATGGG No data
1132453823_1132453827 0 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453827 16:11745-11767 AGTGGAGTTTTCCTGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132453823 Original CRISPR CCAGTGCTCAGCTTGCACCC TGG (reversed) Intergenic
No off target data available for this crispr