ID: 1132453832

View in Genome Browser
Species Human (GRCh38)
Location 16:11768-11790
Sequence AGCCATGCCTAGAGTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132453822_1132453832 29 Left 1132453822 16:11716-11738 CCTGTGCCAGGGTGCAAGCTGAG No data
Right 1132453832 16:11768-11790 AGCCATGCCTAGAGTGGGATGGG No data
1132453823_1132453832 23 Left 1132453823 16:11722-11744 CCAGGGTGCAAGCTGAGCACTGG No data
Right 1132453832 16:11768-11790 AGCCATGCCTAGAGTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132453832 Original CRISPR AGCCATGCCTAGAGTGGGAT GGG Intergenic
No off target data available for this crispr