ID: 1132455050

View in Genome Browser
Species Human (GRCh38)
Location 16:17634-17656
Sequence CTTGCTCTGGATCCTGTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 7, 1: 1, 2: 2, 3: 25, 4: 332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132455046_1132455050 -10 Left 1132455046 16:17621-17643 CCAGGGGGCGCTGCTTGCTCTGG 0: 1
1: 7
2: 0
3: 18
4: 227
Right 1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG 0: 7
1: 1
2: 2
3: 25
4: 332
1132455039_1132455050 16 Left 1132455039 16:17595-17617 CCAGCAGACTTGCAGGGCCCGCT 0: 1
1: 7
2: 0
3: 8
4: 123
Right 1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG 0: 7
1: 1
2: 2
3: 25
4: 332
1132455045_1132455050 -2 Left 1132455045 16:17613-17635 CCGCTCGTCCAGGGGGCGCTGCT 0: 1
1: 7
2: 0
3: 11
4: 92
Right 1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG 0: 7
1: 1
2: 2
3: 25
4: 332
1132455044_1132455050 -1 Left 1132455044 16:17612-17634 CCCGCTCGTCCAGGGGGCGCTGC 0: 1
1: 7
2: 1
3: 18
4: 167
Right 1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG 0: 7
1: 1
2: 2
3: 25
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132455050 Original CRISPR CTTGCTCTGGATCCTGTGGC GGG Exonic
900001667 1:17945-17967 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
900009187 1:90524-90546 TTTGCTCACGATTCTGTGGCTGG - Intergenic
900021388 1:188469-188491 CTTGCTCTGGATCCTGTGCGGGG + Intergenic
900025301 1:267101-267123 TTTGCTCACGATTCTGTGGCTGG - Intergenic
900028903 1:356483-356505 TTTGCTCACGATTCTGTGGCTGG - Intergenic
900585427 1:3430324-3430346 CTTGCTTCGGAGCCTGTGGGGGG - Intronic
900969618 1:5983602-5983624 CTTGCTCTGTATCCTTCTGCTGG + Intronic
902695426 1:18137518-18137540 CTTGCCCAAGATCCCGTGGCTGG + Intronic
903253709 1:22076344-22076366 GTTGCTCTGGAGGCTGAGGCAGG + Intronic
903347833 1:22698835-22698857 TAAGCTCTGCATCCTGTGGCTGG + Intergenic
903613596 1:24634987-24635009 TTTGCTCGGGAGGCTGTGGCAGG + Intronic
903688169 1:25147963-25147985 ATTGCTCTGGATGCTGTGGGGGG + Intergenic
905322722 1:37129385-37129407 CTGGAGCTGGAGCCTGTGGCGGG + Intergenic
907649985 1:56285923-56285945 CTTTCTCTGGATTCAGTGGAAGG - Intergenic
907818617 1:57944875-57944897 CTTGCTCTGCTTCCTGTGTGAGG - Intronic
909763969 1:79331702-79331724 CCTGCTTTGGATTCTGAGGCTGG + Intergenic
910769864 1:90820074-90820096 CTAGCTCTGGAGGCTGAGGCAGG + Intergenic
911332831 1:96545001-96545023 CTTGCTCAAGTTCCTGTGGTAGG - Intergenic
915013111 1:152708299-152708321 CTTTGTATGGATCCTGGGGCTGG - Exonic
915034390 1:152910190-152910212 CTAGCTCTTGATCCAGTTGCTGG - Exonic
916458778 1:164999068-164999090 CATGCCCTGGATACTGTGGATGG - Intergenic
917032908 1:170714619-170714641 TCTGCTCTGCATCCTGTGGGAGG - Intronic
917522450 1:175759503-175759525 CTTCCTCTGCAACCTGTGGAGGG + Intergenic
918158361 1:181872738-181872760 CTTGCTGTGGCTGCTGTGGGGGG - Intergenic
918777381 1:188651274-188651296 CATACTCTGGATCCTGGGTCAGG - Intergenic
919740076 1:200975884-200975906 CTTCCTGTGGATACTGGGGCAGG + Intronic
920346593 1:205309789-205309811 CCTGCCCTGGATCCTCTGGATGG - Intronic
920849169 1:209617097-209617119 CAAGCTCTGGATCCAGTGTCAGG + Intronic
921158457 1:212455934-212455956 CTTGCTGGGGACTCTGTGGCTGG - Intergenic
922792740 1:228319062-228319084 CCTCCTCTGCCTCCTGTGGCAGG - Exonic
922853077 1:228750865-228750887 CTTTCTCATGATCCTGTGGGTGG + Intergenic
924636732 1:245795226-245795248 CCTGGTCAGGATCCTGTGTCTGG + Intronic
1063351073 10:5355545-5355567 CTTGCTCGGTTTCCCGTGGCAGG + Intergenic
1064287475 10:14004428-14004450 GTTGCTCTGGAGGCTGAGGCAGG + Intronic
1064676327 10:17763863-17763885 TTTGCCCAAGATCCTGTGGCTGG - Intronic
1064729491 10:18315580-18315602 GTTGCTCTGGAGCCTGAGGTGGG + Intronic
1065013235 10:21438284-21438306 CTGGCTCAAGATCCTGTAGCTGG - Intergenic
1065798436 10:29328807-29328829 CTTACTCAGGAGCCTGAGGCAGG + Intergenic
1069340404 10:67402836-67402858 TTTGCCAGGGATCCTGTGGCTGG - Intronic
1069360132 10:67632802-67632824 CTTGCCAGGGATCCTGGGGCTGG - Intronic
1070353070 10:75611896-75611918 CTTGCCCTGGAGCCCCTGGCTGG + Intronic
1070382387 10:75892678-75892700 CTGCCTCTGGCACCTGTGGCTGG + Intronic
1071904828 10:90161304-90161326 CTTCCTCTTGATCTTGAGGCAGG + Intergenic
1073224079 10:101901672-101901694 CTGGGTGTGGATACTGTGGCAGG + Intronic
1073767261 10:106696526-106696548 GGTGCTCTGCATCCTGGGGCTGG - Intronic
1074084050 10:110194048-110194070 CCAGCTCTGAACCCTGTGGCAGG + Intergenic
1075219575 10:120572888-120572910 CCTGCTCTAGATACTGTGGTGGG - Intronic
1076783536 10:132737563-132737585 CGTGCTCTGGATGGTGAGGCAGG + Intronic
1077037555 11:502715-502737 CTTGCTTCGGACACTGTGGCCGG - Exonic
1078909847 11:15720713-15720735 CGTGCTCTAGAGCCTGTGGAGGG - Intergenic
1080439368 11:32277058-32277080 CTTGCTCTGTCGCCAGTGGCTGG + Intergenic
1081744632 11:45464284-45464306 CTCTCTCTGGCTCCTGTGGCTGG - Intergenic
1081772283 11:45657496-45657518 CTTGCACTGGATTCAGTGTCAGG - Intronic
1081950849 11:47041166-47041188 CTTGGCCTGGATCTTGTGTCAGG + Intronic
1082092438 11:48101019-48101041 CTTTCTCAGGTTCCTGTAGCTGG + Intronic
1083781975 11:64923460-64923482 CTTGCTCAGGAACCTCCGGCAGG - Intronic
1084139788 11:67218632-67218654 CTTGCTCTGTAGCCTCAGGCTGG + Intronic
1084214991 11:67642315-67642337 ATTGCTCTGGATCCAGCGGAGGG - Intergenic
1084235901 11:67787957-67787979 TGTGCTCTGGAGGCTGTGGCTGG + Intergenic
1084976970 11:72806459-72806481 CTTACTCTGATTCCTGAGGCTGG + Intergenic
1085053316 11:73390745-73390767 CCTGCCCTGGGTCCTGTGGGAGG - Exonic
1085240631 11:75051071-75051093 CTTGCTGTGGCTCCTGTGTCAGG + Intergenic
1085450485 11:76629297-76629319 CTGGCTCTGTGTCCTGTGCCAGG + Intergenic
1088094137 11:106077995-106078017 CTCGCTGTGGAGCCTGTGGCCGG + Intronic
1088372454 11:109106643-109106665 CTTGCTGTGGCTGCTGTTGCAGG + Intergenic
1088694901 11:112358350-112358372 ATTGCTCTGGATGCTGCCGCAGG + Intergenic
1089052833 11:115560750-115560772 ATTGCTCTGGAAGCTGAGGCAGG + Intergenic
1089767144 11:120776292-120776314 CTTCCTCCGGCTCCTGGGGCTGG - Intronic
1090029295 11:123194197-123194219 TTTGCTCTGGAGCCTGTTTCAGG + Intronic
1090973017 11:131659085-131659107 CCTGCTCTGGACCCTGAGGGAGG - Intronic
1091240012 11:134046071-134046093 CCTGCTCAGGAGCCTGGGGCAGG - Intergenic
1091240024 11:134046116-134046138 CCTGCTCAGGAGCCTGGGGCAGG - Intergenic
1091240036 11:134046161-134046183 CCTGCTCAGGAGCCTGGGGCAGG - Intergenic
1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1092076270 12:5676108-5676130 TCTGCTCTTGATCCTGTGACTGG - Intronic
1092720753 12:11438186-11438208 CTTGCTCTGGATCACATGCCTGG - Intronic
1092990645 12:13895200-13895222 CTTGCTCAGGATCACTTGGCTGG + Intronic
1093809201 12:23472158-23472180 CTTGCTCTTGGTCCTGGGTCTGG - Intergenic
1094696036 12:32819759-32819781 CCTGGTCTGGATTCTGTGGGAGG + Intronic
1097886116 12:64731186-64731208 GTTGCTCTGGATGCTGAGGCAGG - Intronic
1099285916 12:80714358-80714380 CTTTCCCTGGCTCCTGTGCCTGG - Intergenic
1099854068 12:88142010-88142032 CTTGCTCGGGACCATTTGGCTGG - Exonic
1101019298 12:100536333-100536355 CTTTCTCTGGGTCCTCAGGCAGG - Intronic
1101269083 12:103124006-103124028 CTTGCTGGGGATTCTTTGGCAGG - Intergenic
1101852268 12:108413152-108413174 CTTTATTTGGATCCTGTGGTGGG + Intergenic
1102077018 12:110067700-110067722 CATGTGCTGGTTCCTGTGGCAGG - Intronic
1102550073 12:113685280-113685302 TTTGGGCTGGCTCCTGTGGCTGG + Intergenic
1103739460 12:123081536-123081558 CTTTCTCAGGCTCCTCTGGCAGG + Intronic
1104600934 12:130152838-130152860 CCTCCTCTGGACCCTGTGGTGGG - Intergenic
1104678094 12:130729394-130729416 CCTGCTGTGGACTCTGTGGCTGG + Intergenic
1105328579 13:19393218-19393240 CTTGCTCTGTTGCCTGAGGCTGG - Intergenic
1105863301 13:24436331-24436353 CTTGCTCTGTTGCCTGGGGCTGG + Intronic
1105947193 13:25200351-25200373 CCTGCTCAGGAGCCTGAGGCAGG - Intergenic
1108319879 13:49279249-49279271 CGTGCTGTGGATTCTGTGGGAGG + Intronic
1108377941 13:49830509-49830531 CTTGCTGTGGTTCCTGTGAAAGG + Intergenic
1108386469 13:49903895-49903917 CCTGCTCTGGAGGCTGAGGCAGG - Intergenic
1110152963 13:72276894-72276916 CCTGCTCTGGAGGCTGAGGCAGG + Intergenic
1112092247 13:96093680-96093702 CTTGCTCTAGATACTGTAGGAGG + Intronic
1114487427 14:23071288-23071310 CTCTCTCTGGATCGGGTGGCTGG - Intronic
1115852870 14:37601227-37601249 CTTGCTCTGGATGCCTTGCCAGG + Intronic
1116364569 14:44043555-44043577 GTTGCTCTGGAGGCTGAGGCAGG - Intergenic
1117481299 14:56148070-56148092 CTTGCACTGGATTCTGTCTCAGG + Intronic
1118290737 14:64519664-64519686 GCTACTCTGGATGCTGTGGCGGG + Intronic
1119270910 14:73303466-73303488 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1119838762 14:77774594-77774616 CTTACTCTGGAGGCTGAGGCAGG - Intergenic
1121215206 14:92242447-92242469 CCGGCCCTGGATCCTGAGGCTGG + Intergenic
1122024848 14:98868188-98868210 CTTTCTCAAGATCATGTGGCTGG - Intergenic
1122265553 14:100545054-100545076 GTTGCTCTGAATCCTGGTGCAGG + Exonic
1125203421 15:37123064-37123086 CTTTCTCTGGATGCTGTTGTGGG + Intergenic
1125655155 15:41350472-41350494 CTTGCTCTGGAACCAGGGGTCGG + Intronic
1125728799 15:41881684-41881706 CTTGGCCTGGCTCCTGTTGCCGG - Intronic
1126632999 15:50756247-50756269 CTTACTCTGGAGGCTGAGGCAGG + Intronic
1126988716 15:54345390-54345412 CTTACTCTGGGTCATGTGGCAGG + Intronic
1128654541 15:69450779-69450801 GTTACTCTGGAGGCTGTGGCAGG + Intergenic
1129958058 15:79657245-79657267 ATTGGTCTGGATTATGTGGCTGG - Intergenic
1130360165 15:83176727-83176749 CTTGCTGTGGTTCCTGCGGATGG + Intronic
1131556812 15:93406755-93406777 GCTGCTCTGGAGGCTGTGGCGGG + Intergenic
1132006893 15:98235509-98235531 CATCCTCTGGCACCTGTGGCTGG + Intergenic
1132451842 15:101972995-101973017 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG + Exonic
1132533534 16:466122-466144 CTTGCTCTGCACAATGTGGCTGG + Intronic
1133034627 16:3027976-3027998 CTTGCCCAGCATCCTGGGGCGGG + Exonic
1133127897 16:3658000-3658022 TTTTTTCTGGGTCCTGTGGCAGG - Exonic
1133257628 16:4527036-4527058 CTCTCTCAGGCTCCTGTGGCAGG - Intronic
1133968592 16:10550322-10550344 CTTGGATTGGATCCTGGGGCAGG - Intronic
1134112938 16:11527201-11527223 GCTGCTCTGGAGCCTGAGGCTGG - Intergenic
1134206776 16:12244495-12244517 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1134533091 16:15000370-15000392 CTTGCTCGAGGTCATGTGGCAGG + Intronic
1135435218 16:22422262-22422284 GTTACTCAGGAGCCTGTGGCAGG + Intronic
1135510239 16:23076540-23076562 CTAGCTCTGTGTCCTGGGGCAGG - Intronic
1135750604 16:25055697-25055719 CTTGCACTGGATGCTGGGGTTGG + Intergenic
1136386933 16:29933637-29933659 CTTGCTCAGGAGGCTGAGGCAGG + Intergenic
1136984280 16:35084625-35084647 ATTCCTCTGGACACTGTGGCAGG - Intergenic
1137366413 16:47863465-47863487 CTTGCCCTGAATCCTGAGGAAGG + Intergenic
1139313030 16:66043053-66043075 CCTGCACTGGATCCTGTGGATGG - Intergenic
1139862942 16:70040358-70040380 CTTGCTCGAGGTCATGTGGCAGG - Intergenic
1140221061 16:73044325-73044347 CTTGCTCTGGTTCCTAAGGCTGG - Intronic
1140825545 16:78702541-78702563 CTTGCTCGGGAGGCTGAGGCAGG + Intronic
1141725837 16:85787788-85787810 CTCCCTCAGGATCCTGTGCCTGG + Intronic
1141916370 16:87099962-87099984 CATGCTCTGGAGCCTGTGTGTGG - Intronic
1142117972 16:88370056-88370078 GTTGCCCTTGATCCTGTGGCCGG + Intergenic
1142455136 16:90216378-90216400 TTTGCTCACGATTCTGTGGCTGG + Intergenic
1142850130 17:2700813-2700835 GTGGCGCTGGACCCTGTGGCAGG + Exonic
1143772172 17:9175720-9175742 CTTGCTCTGGGTCATGAGACAGG - Intronic
1144362473 17:14508373-14508395 CATGCTCTGGAGCCTGAGACCGG + Intergenic
1144665828 17:17101766-17101788 ACTGCTATGGCTCCTGTGGCAGG + Intronic
1145010758 17:19366342-19366364 CTTGTCCTGGGTCCTGGGGCAGG + Intronic
1145293963 17:21573856-21573878 CTTTCCCTGGGTCCTGTGGCCGG - Intronic
1145751158 17:27356078-27356100 GTTGCTCGGGAGCCTGAGGCAGG - Intergenic
1145869867 17:28265326-28265348 ATTGCTCTGGCTCCGGGGGCAGG - Intergenic
1147192587 17:38746745-38746767 CATGGTCTGGATCCTGGGGTTGG + Intronic
1148667713 17:49387205-49387227 TTTGCACTTTATCCTGTGGCAGG - Intronic
1148856238 17:50580626-50580648 CTTGCTCAGGCTCCTGAGGAAGG + Intronic
1149498431 17:57133819-57133841 CTTGCTGGGTATCCTGGGGCTGG - Intergenic
1150639651 17:66940810-66940832 CATGCTTTGGATCATGTGGCAGG - Intergenic
1151307467 17:73272491-73272513 TTTGCTCTCGTTGCTGTGGCTGG - Intergenic
1151374044 17:73671650-73671672 CTTGCTCGGGAGGCTGAGGCAGG + Intergenic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1151967275 17:77437899-77437921 CTTGCGCTGGTGACTGTGGCTGG + Intronic
1152365763 17:79855538-79855560 CCAGCTCTGGAACCTTTGGCTGG - Intergenic
1152950855 17:83230074-83230096 TTTGCTCACGATTCTGTGGCTGG + Intergenic
1154369107 18:13742221-13742243 CTTGCTCAGGAGGCTGAGGCAGG + Intronic
1154481691 18:14833358-14833380 GTTGCTCTGGAGGCTGAGGCAGG - Intronic
1157276760 18:46315986-46316008 CTTGCTCTCTCTTCTGTGGCTGG + Intergenic
1157575843 18:48742449-48742471 ATTGCTACGGTTCCTGTGGCAGG - Intronic
1158609033 18:58922075-58922097 CTTGCTCTGTCACCTGAGGCTGG - Intronic
1160368584 18:78350758-78350780 CCTGCTCTGGCCCCTGTTGCAGG - Intergenic
1161574068 19:5046195-5046217 CTTCCCCTGGCACCTGTGGCAGG - Intronic
1161603970 19:5204276-5204298 CTATCTCTGGCTCCTGTGGGTGG + Intronic
1161691082 19:5734688-5734710 CTTACTCTGGAGCCCGAGGCAGG + Intronic
1161848719 19:6727437-6727459 CTTGCCCGAGATCCTGTGGCTGG + Intronic
1162736015 19:12747558-12747580 CTTGGCCTGGATCTTGTGACGGG - Exonic
1163102353 19:15105924-15105946 CTTGCTCGGGAGGCTGAGGCAGG + Intergenic
1165448456 19:35869292-35869314 CTTGCTCAGGCTCCCGTTGCAGG - Intronic
1165676600 19:37730337-37730359 GCTGCTCTGGAGCCTGAGGCAGG - Intergenic
1165874711 19:38998001-38998023 CTTACTCTGGAGGCTGGGGCAGG + Intronic
1166569265 19:43783365-43783387 CTTGCTCTGTCTCCCATGGCTGG + Intergenic
1166782203 19:45348636-45348658 CTTGTTCTGGTCCCTGTGGGGGG - Exonic
1167384217 19:49154758-49154780 ATGGCTGTGGCTCCTGTGGCTGG + Exonic
925652328 2:6104328-6104350 CTTGCTGTGGCTGCTGTGGGGGG + Intergenic
925867466 2:8241395-8241417 CTTGCTCTGGTGTCTCTGGCAGG - Intergenic
928147259 2:28790167-28790189 CTTGCTTGGGAGGCTGTGGCAGG + Intronic
930037092 2:47093090-47093112 CTTGCTTTAAATCCTGTGGAAGG - Intronic
930284847 2:49415022-49415044 GCTGCTCTGGATGCTGAGGCAGG - Intergenic
930857357 2:56033195-56033217 CTTGCTCTGGGGCCTTGGGCAGG + Intergenic
935624985 2:105164471-105164493 CATGCTCTGGAGGCTGAGGCAGG + Intergenic
936260731 2:110957945-110957967 CTTACTCTGGAGGCTGAGGCAGG + Intronic
936568056 2:113595463-113595485 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
937081201 2:119141302-119141324 CTTGCTCAAGATCATGTAGCTGG - Intergenic
937257446 2:120565243-120565265 ATTGCTCTGGGCCCTGTGGCTGG + Intergenic
940133302 2:150408445-150408467 CTTGCTCTGGAGTCTGAGGTTGG + Intergenic
940310309 2:152272391-152272413 CTTGCTCAGGAGGCTGAGGCAGG - Intergenic
940373400 2:152926238-152926260 CTTGCGCTGGTGCCTCTGGCAGG - Intergenic
941231678 2:162917843-162917865 CCTGCTCTGGAGCCTGTTGTGGG - Intergenic
942971726 2:181964815-181964837 GCTACTCTGGAGCCTGTGGCAGG - Intronic
943395267 2:187325670-187325692 CTTGCTCTCAATAATGTGGCTGG - Intergenic
944056900 2:195531745-195531767 CTTGCTCAGGATCACATGGCAGG + Intergenic
944456587 2:199901323-199901345 GCTGCTCTGGATGCTGAGGCAGG - Intergenic
945951237 2:216040757-216040779 GCTACTCTGGATCCTGAGGCAGG + Intronic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
948811810 2:240482227-240482249 CTTCTTCTTCATCCTGTGGCTGG + Exonic
948871221 2:240799218-240799240 CCTGCTCTTGATCCTGTCCCAGG - Intronic
949086606 2:242161045-242161067 TTTGCTCACGATTCTGTGGCTGG + Intergenic
1168786438 20:543765-543787 CTCGCTCTGGTCCCTGCGGCTGG - Exonic
1169844667 20:9976599-9976621 CCTGCTCATGATCCTCTGGCAGG + Intergenic
1171210912 20:23316252-23316274 CATTCCCTGGATCCTGGGGCAGG - Intergenic
1171214960 20:23345682-23345704 CTTGCTCAGGAGGCTGAGGCAGG - Intergenic
1172186047 20:33031647-33031669 CATGCTGCGGATCCTGTGCCTGG + Exonic
1172476102 20:35238983-35239005 GCTGCTCTGGAGACTGTGGCAGG - Intronic
1173914415 20:46696290-46696312 CTGGTTCTGGCTTCTGTGGCAGG + Intergenic
1174419987 20:50393324-50393346 CTTGCCCAGGATCCCCTGGCAGG + Intergenic
1175069068 20:56316520-56316542 CTTGCTGTGGCTGCTGTGGGGGG - Intergenic
1175169398 20:57069679-57069701 CTTGGCCTGAATACTGTGGCCGG - Intergenic
1175895436 20:62333798-62333820 CTTCCTCTGGCTCATGTGGGTGG - Intronic
1175948279 20:62568832-62568854 CTTGCTCTGGAGGCTCTGACTGG - Intronic
1176155563 20:63618400-63618422 CTTGCTGTGGAGCCTGTTGTTGG - Intronic
1179614740 21:42575112-42575134 CTTGCTCTGCAGCCTTGGGCGGG + Intronic
1180856188 22:19047156-19047178 CTAGCTCTGGGTCCTCTGGTGGG + Intronic
1182344684 22:29653330-29653352 GTTGCTCAGGATACTGAGGCAGG + Intronic
1183251420 22:36733005-36733027 CTTGCTCTGTATCCTGAGCCTGG + Intergenic
1183667731 22:39255055-39255077 CTTGGTCTGGCTGCTGGGGCAGG - Intergenic
1184141316 22:42579023-42579045 GCTGCTCGGGATGCTGTGGCAGG + Intergenic
1184473196 22:44707374-44707396 CATGCCCTGGGTCCTGAGGCTGG - Intronic
1184939162 22:47748302-47748324 CTTCCTGTGGACCCAGTGGCGGG + Intergenic
1185211715 22:49574289-49574311 CTTGCCCTTGAGCCTGTGGGAGG + Intronic
949310991 3:2697918-2697940 ATTGCCCTGGAACCTGTGGGTGG - Intronic
949492244 3:4600399-4600421 CTTGCTGGGGATACTGTGGATGG + Intronic
950273559 3:11639440-11639462 CTTGCTCTGAAGCCAGTTGCTGG - Intronic
950687643 3:14629972-14629994 CTTGCTCAGGAGAATGTGGCAGG + Intergenic
952738981 3:36717225-36717247 GTTGCTCTGGAGGCTGAGGCAGG - Intronic
953968001 3:47325011-47325033 ATGGCTCTGGAGTCTGTGGCAGG - Intronic
954423799 3:50432711-50432733 CCTGCTCTGGGTCCTCTGGGTGG + Intronic
954767700 3:52934938-52934960 GTTTCTCTGCATTCTGTGGCTGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956187716 3:66578510-66578532 ATTGTTCAGGATCATGTGGCTGG + Intergenic
956703361 3:71978537-71978559 CTTGCCCTGGATCCTGTGGCTGG + Intergenic
957207640 3:77218166-77218188 CTTGCTCTGGATGCTTTCACTGG + Intronic
959156595 3:102673968-102673990 CTTGCACTGGAAGCTGTGGCTGG + Intergenic
961500503 3:127329707-127329729 CTCCCTCTGGATCCTTGGGCTGG - Intergenic
961885462 3:130093938-130093960 TGTGCTCTGGAGGCTGTGGCAGG + Intronic
962608840 3:137055797-137055819 TTTGCCCTGGCTCATGTGGCTGG + Intergenic
963122697 3:141789537-141789559 CTTCCTCTGGCTCCTGGGACAGG - Intronic
963565221 3:146921202-146921224 CTTACTCAGGATGCTGAGGCAGG - Intergenic
963622977 3:147635247-147635269 CTTGCTGTGGCCACTGTGGCAGG - Intergenic
963812532 3:149792953-149792975 ATTGTTCTGTACCCTGTGGCAGG - Intronic
965202815 3:165681702-165681724 CCTGTTTTGGTTCCTGTGGCTGG - Intergenic
965588374 3:170340017-170340039 CTTGCTCTTGTTCCCGAGGCTGG + Intergenic
968437284 4:600309-600331 CTTGCCAGGGATCCTGGGGCCGG + Intergenic
968994666 4:3938130-3938152 TGTGCTCTGGAGGCTGTGGCAGG + Intergenic
969123867 4:4931550-4931572 CTTGCCCTGGAGCATGTGTCTGG + Intergenic
969277618 4:6147577-6147599 CTTGAGCTGGATCCTGAGCCTGG - Intronic
969759332 4:9170663-9170685 TGTGCTCTGGAGGCTGTGGCAGG - Intronic
973114916 4:46443936-46443958 GTTGCTCTGGAGGCTGAGGCAGG + Intronic
976149643 4:82079087-82079109 CTTGCTCTGCTGCCTGTGGCTGG - Intergenic
976556192 4:86453586-86453608 CTTGCTGTGGCTGCTGTGGTGGG - Intronic
978740693 4:112134802-112134824 GTTTCTCTGGAGGCTGTGGCGGG + Intergenic
980917303 4:139045626-139045648 GTTGCTCTGGAGGCTGAGGCAGG - Exonic
981193777 4:141894618-141894640 CCTGCTCAGGATGCTGAGGCAGG - Intergenic
981760792 4:148192648-148192670 CTTGCTGTGGCTGCTGTGGGGGG + Intronic
982397285 4:154925953-154925975 CTTGCCAGGGATCCTGGGGCTGG + Intergenic
982673403 4:158348716-158348738 CTTGCCCTGTACCCTGTGGGAGG + Intronic
984491187 4:180437082-180437104 CCTGCAGTGGATCCTGGGGCGGG + Intergenic
987624791 5:20384946-20384968 GTTGCTCTGGAGACTGAGGCAGG - Intronic
987671245 5:21012689-21012711 CATGCTCTGTATCCTGAGGCTGG + Intergenic
987706820 5:21469328-21469350 CTTACTCTGGAGGCTGAGGCAGG - Intergenic
988815419 5:34829942-34829964 ATTGCTTTGGATTCTGTGTCAGG + Intronic
989058785 5:37389520-37389542 CTTACTCTGGAGGCTGAGGCAGG - Intronic
991652698 5:68872391-68872413 CTTGCTCTGAAACCTGAGTCAGG + Intergenic
992242264 5:74784478-74784500 CTTGCTCTGTCTCCCTTGGCTGG - Intronic
992611603 5:78512864-78512886 GCTGCTCTGGATGCTGAGGCAGG - Intronic
994210405 5:97082202-97082224 CTTTCTGTGGATCCTCTGGTGGG + Intergenic
994252023 5:97547143-97547165 GTTCCTCTGGAACCTGTGGTGGG - Intergenic
994606353 5:101972214-101972236 CTTGCTCGGGAGGCTGAGGCAGG - Intergenic
996098591 5:119424620-119424642 CTTGCTCTGCATATTCTGGCTGG + Intergenic
996368192 5:122725131-122725153 CTTGCTCTGGTTCCCCGGGCTGG - Intergenic
996396676 5:123020933-123020955 CTTGCCCTGGCTCCAGTGACTGG - Intronic
998112665 5:139514195-139514217 CTGGCTCTGGAACCTTAGGCAGG - Intergenic
999370340 5:151051433-151051455 CTTGCTCTCCATCCTGTGAGTGG - Intronic
999484859 5:151985330-151985352 CTTGCTGTGGTTGCTGTGGGGGG + Intergenic
999683233 5:154079330-154079352 CTTGCTGGAGATCCAGTGGCTGG + Intronic
999826094 5:155275077-155275099 CTTGCCCAGGGTCCTTTGGCTGG + Intergenic
999882504 5:155882136-155882158 CTTGCTCTGTTTCCCCTGGCTGG + Intronic
1001266089 5:170275610-170275632 CCTGCTCTGCATCCTGTCCCTGG - Intronic
1001864505 5:175091858-175091880 GTTGCTCTGGAGGCTGAGGCAGG - Intergenic
1002745087 5:181463888-181463910 TTTGCTCACGATTCTGTGGCTGG + Intergenic
1002874669 6:1200640-1200662 TTTCCTGTGGATCCTGAGGCAGG - Intergenic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1007620371 6:43209755-43209777 GTTGCTCTGGAGGCTGAGGCAGG - Intronic
1008451581 6:51657259-51657281 CTGGCTCTGGAGACTGTGTCGGG + Intronic
1008617363 6:53239637-53239659 CCTGCTCTGGGTCCATTGGCTGG + Intergenic
1009021404 6:57951171-57951193 CTTACTCTGGAGGCTGAGGCAGG + Intergenic
1011613852 6:89180222-89180244 CTAGCTCTGGAACCTCAGGCAGG - Intronic
1013104379 6:107014227-107014249 TTTGCCCTGGATCATGTTGCTGG - Intergenic
1015768564 6:136745461-136745483 CTGCCTCTGGCTGCTGTGGCAGG + Intronic
1018404606 6:163465515-163465537 CTTGCTCGGGAGGCTGAGGCAGG + Intronic
1018907905 6:168085858-168085880 CGGGCTTTGGATGCTGTGGCTGG - Intergenic
1019249997 6:170737434-170737456 TTTGCTCACGATTCTGTGGCTGG + Intergenic
1020318939 7:6926502-6926524 TGTGCTCTGGAGGCTGTGGCAGG + Intergenic
1021465038 7:20932857-20932879 CTTGGTCTGGAAGCTGTGACAGG + Intergenic
1022019872 7:26388288-26388310 CTTGTTCTGCTTCCTGTGGACGG - Intergenic
1024250805 7:47504401-47504423 CATGCCCTGGAGCATGTGGCTGG - Intronic
1026336321 7:69397037-69397059 CTTTCTCTGGGTCCTGTGTAAGG - Intergenic
1026866765 7:73828902-73828924 CTTGCTCTGTTGCCCGTGGCTGG + Exonic
1028483531 7:91334001-91334023 TTTAGTCTGGATCTTGTGGCTGG + Intergenic
1028743010 7:94297790-94297812 ATTGCTATCGATCCTGTGGAGGG - Intergenic
1028814919 7:95132742-95132764 CTAAGTGTGGATCCTGTGGCGGG - Intronic
1030084111 7:105802708-105802730 GTTCCTCTGGATTCTGTGGCTGG - Intronic
1030790545 7:113722263-113722285 CATGCTCTGTATCCTGCTGCTGG + Intergenic
1031270919 7:119647862-119647884 GTTACTCTGGAGGCTGTGGCAGG + Intergenic
1031725873 7:125237488-125237510 CTTGCTCTTGTTCCCCTGGCTGG - Intergenic
1032076713 7:128839472-128839494 ATTTTTCTGGATTCTGTGGCAGG + Intronic
1032500614 7:132396979-132397001 CTGGGTCTGGATCTTGGGGCAGG - Intronic
1033228897 7:139581617-139581639 CATGCTCTGGGTGCTGTAGCTGG + Intronic
1033565004 7:142569860-142569882 CTTGCTGGGGATCCTGAGGCTGG - Intergenic
1034113163 7:148557899-148557921 CCTGCTCTTGATCCTGGGTCTGG + Intergenic
1034902839 7:154918082-154918104 TGTGCTCAGGATCCTGTGGGAGG - Intergenic
1035172080 7:157022331-157022353 CTTGCCGAGGGTCCTGTGGCCGG + Intergenic
1035498102 8:70224-70246 TTTGCTCACGATTCTGTGGCTGG - Intergenic
1035566148 8:642853-642875 CTTGCCCTGGCACCTGTGGCAGG + Intronic
1036381479 8:8238694-8238716 TGTGCTCTGGAGGCTGTGGCAGG - Intergenic
1037582728 8:20255134-20255156 CTTGCTGTGGAAGCTGTGGCCGG + Exonic
1037674412 8:21041492-21041514 CTGGCTCTGGGTGCAGTGGCAGG + Intergenic
1037784647 8:21895394-21895416 CTTACTCTGGAGGCTGAGGCAGG - Intergenic
1037814000 8:22102446-22102468 CATGCTCTGCATGGTGTGGCAGG + Intronic
1038247981 8:25877087-25877109 TTTGCCCTGGATTCTGTGGTTGG + Intronic
1039089209 8:33810417-33810439 CTTGCTCTGTTGCCTGAGGCTGG - Intergenic
1039728899 8:40253206-40253228 CCAGTTCTGGGTCCTGTGGCCGG - Intergenic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1042514890 8:69648625-69648647 ATTGCACTTGTTCCTGTGGCTGG + Intronic
1042734682 8:71974835-71974857 GTTACTCTGGAGCCTGAGGCAGG + Intronic
1044526765 8:93261155-93261177 CTTGCTCTGGATACTATAGACGG + Intergenic
1047000410 8:120567448-120567470 CTTGCTCTGGACCCAGGCGCTGG + Intronic
1047320351 8:123773893-123773915 TTTGCTCTGAATACTGTAGCAGG + Intronic
1048210494 8:132450578-132450600 CCTGCTATGGAACCTGTGGCTGG - Intronic
1048971151 8:139645578-139645600 CCTGCTCTGGGCCCTGTGTCAGG - Intronic
1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1051578086 9:18640261-18640283 CTTGCTCACGTTCATGTGGCTGG - Intronic
1051913805 9:22184774-22184796 TTTGCTGGGGATCCTGGGGCCGG - Intergenic
1055689377 9:78812663-78812685 CCTGTTCTGGGTCCTGTTGCGGG + Intergenic
1056699041 9:88887073-88887095 CTTGCTGTGGCTGCTGTGGGGGG + Intergenic
1056707798 9:88966869-88966891 CCAGCTCTGGGTCCTGGGGCAGG + Intergenic
1056755000 9:89376252-89376274 CTGGCTCTGGAGGCTGAGGCAGG + Intronic
1056912459 9:90714837-90714859 CTTGCTCTTATTCCTGGGGCAGG - Intergenic
1057274531 9:93669278-93669300 CTTGCCCTGCATCCTCTGGCAGG - Intronic
1060406004 9:123373441-123373463 CTCGCGCTGGCTGCTGTGGCTGG + Exonic
1060408508 9:123384451-123384473 CTTGCTGTGGGACCTTTGGCAGG + Intronic
1060636319 9:125202101-125202123 CTTACTCTGGAGGCTGAGGCAGG + Intronic
1062495849 9:136831338-136831360 CTTGGTGTCGACCCTGTGGCTGG - Intronic
1203579557 Un_KI270745v1:30019-30041 TTTGCTCACGATTCTGTGGCTGG + Intergenic
1185961589 X:4550761-4550783 CTTACTCAGGATGCTGAGGCAGG - Intergenic
1187891718 X:23942376-23942398 CTCCCTCTCGTTCCTGTGGCTGG + Intergenic
1187910017 X:24103172-24103194 GTTACTCAGGATCCTGAGGCAGG - Intergenic
1189166423 X:38865411-38865433 CTTGCTCTGATTACTGTGCCAGG + Intergenic
1189285155 X:39847022-39847044 TTTACTCTGGCTCCTGTGGATGG - Intergenic
1190245165 X:48686023-48686045 CTAGCCCAGGAACCTGTGGCAGG + Intronic
1190572310 X:51796202-51796224 CTTACTCAGGATGCTGAGGCCGG - Intergenic
1193826309 X:86231443-86231465 CTTGCTGTGGCTGCTGTGGGGGG + Intronic
1196727414 X:118908829-118908851 CCTGCTCTGGAGGCTGAGGCAGG - Intergenic
1197401576 X:125998354-125998376 CTTGGTCTTTGTCCTGTGGCGGG + Intergenic
1198119587 X:133578930-133578952 CTTGGTCTTGATCCTGTAGCAGG - Intronic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1198691437 X:139289243-139289265 CTTGTTCAGCATCCTATGGCTGG - Intergenic
1200117402 X:153775410-153775432 CTTGACCTGGACCCGGTGGCGGG + Intronic
1200210187 X:154343678-154343700 CTCCCTCTGGAGGCTGTGGCAGG + Intergenic
1200220665 X:154388414-154388436 CTCCCTCTGGAGGCTGTGGCAGG - Intergenic
1200243025 X:154507648-154507670 CTTGGTCTGGAGGCTGTGGGAGG - Intronic
1200401331 X:156022093-156022115 CTTGCTCTGGATCCTGTGGCGGG - Intergenic