ID: 1132457913

View in Genome Browser
Species Human (GRCh38)
Location 16:34217-34239
Sequence TGCTGGGCCCACTGTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132457898_1132457913 30 Left 1132457898 16:34164-34186 CCAGCTCAAAGGCTCCAAGTATG No data
Right 1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG No data
1132457902_1132457913 -3 Left 1132457902 16:34197-34219 CCCCAACGATGTGATCCCTGTGC No data
Right 1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG No data
1132457903_1132457913 -4 Left 1132457903 16:34198-34220 CCCAACGATGTGATCCCTGTGCT No data
Right 1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG No data
1132457900_1132457913 16 Left 1132457900 16:34178-34200 CCAAGTATGAGCCAGGTCACCCC No data
Right 1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG No data
1132457901_1132457913 5 Left 1132457901 16:34189-34211 CCAGGTCACCCCAACGATGTGAT No data
Right 1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG No data
1132457904_1132457913 -5 Left 1132457904 16:34199-34221 CCAACGATGTGATCCCTGTGCTG No data
Right 1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132457913 Original CRISPR TGCTGGGCCCACTGTGGGGG TGG Intergenic
No off target data available for this crispr