ID: 1132461117

View in Genome Browser
Species Human (GRCh38)
Location 16:55343-55365
Sequence GCTCCATTTTACGAAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132461117_1132461125 26 Left 1132461117 16:55343-55365 CCTTGCCCTTCGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132461125 16:55392-55414 TTCTTTGTTGTTGCTCAAGGTGG 0: 1
1: 0
2: 0
3: 31
4: 718
1132461117_1132461124 23 Left 1132461117 16:55343-55365 CCTTGCCCTTCGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132461124 16:55389-55411 TTGTTCTTTGTTGTTGCTCAAGG 0: 1
1: 0
2: 4
3: 66
4: 462
1132461117_1132461121 -1 Left 1132461117 16:55343-55365 CCTTGCCCTTCGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132461121 16:55365-55387 CACCACTTTTTGGCCACTATCGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132461117 Original CRISPR GCTCCATTTTACGAAGGGCA AGG (reversed) Intronic