ID: 1132461117

View in Genome Browser
Species Human (GRCh38)
Location 16:55343-55365
Sequence GCTCCATTTTACGAAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132461117_1132461121 -1 Left 1132461117 16:55343-55365 CCTTGCCCTTCGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132461121 16:55365-55387 CACCACTTTTTGGCCACTATCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1132461117_1132461124 23 Left 1132461117 16:55343-55365 CCTTGCCCTTCGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132461124 16:55389-55411 TTGTTCTTTGTTGTTGCTCAAGG 0: 1
1: 0
2: 4
3: 66
4: 462
1132461117_1132461125 26 Left 1132461117 16:55343-55365 CCTTGCCCTTCGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132461125 16:55392-55414 TTCTTTGTTGTTGCTCAAGGTGG 0: 1
1: 0
2: 0
3: 31
4: 718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132461117 Original CRISPR GCTCCATTTTACGAAGGGCA AGG (reversed) Intronic
900974404 1:6008140-6008162 TCTCCATGTTGCGAAGGGCAGGG + Intronic
901381559 1:8878144-8878166 CCTCCATTTTAGGAAGGGCCTGG + Intronic
901689059 1:10960768-10960790 GCTGCATTTAGCCAAGGGCAAGG + Intronic
906301812 1:44687955-44687977 GGTCCATTTAAGGCAGGGCAAGG + Intronic
907238104 1:53065061-53065083 GCTCCATTCTTAGAAGAGCAAGG + Intronic
912752958 1:112300683-112300705 GCTGCAGTTTAAGGAGGGCATGG + Intergenic
921099640 1:211917294-211917316 GGTACATTTTAGGAAGGGCACGG + Intergenic
924459340 1:244244680-244244702 GTTCCCTTTTCCCAAGGGCAGGG - Intergenic
1071380773 10:85057152-85057174 GCTGCTTTTTACAAAGGGAAAGG + Intergenic
1073460701 10:103664174-103664196 GCCCCATTTCTCGTAGGGCAGGG - Intronic
1077988987 11:7384853-7384875 TCTGCATTTGAGGAAGGGCAAGG - Intronic
1078181229 11:9013028-9013050 GCTCTATTTTAAAAAGGGGAGGG - Intergenic
1085179467 11:74521380-74521402 GCTCTATTTCACCAAGGACAAGG + Intronic
1089635701 11:119810249-119810271 GCTACATTTTAGGAAGGGATGGG + Intergenic
1110280330 13:73685563-73685585 ACTCCATTCTACAAAGGGAATGG - Intergenic
1111191318 13:84810728-84810750 GCTTCATTTAACTAAGGTCACGG - Intergenic
1114578316 14:23733294-23733316 GCTCCACATGAGGAAGGGCAGGG + Intergenic
1120419844 14:84270029-84270051 GCTCTATTTTACTTATGGCATGG - Intergenic
1124116619 15:26849397-26849419 TGTCCATTTTACAAAGAGCAAGG + Intronic
1128314993 15:66654781-66654803 GCTCCAGTTTGGGGAGGGCAGGG - Intronic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1133670097 16:8010142-8010164 GCTTCATTTTAAGCAGTGCAAGG - Intergenic
1136694181 16:32062196-32062218 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1136794678 16:33005460-33005482 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1136875232 16:33848932-33848954 TCTCCATTTCAGGGAGGGCAGGG + Intergenic
1141206856 16:81939399-81939421 GCTACTTTTTACCAGGGGCAAGG - Intronic
1141753938 16:85978839-85978861 TCTCCATTTTTCCAAGGGCAAGG - Intergenic
1203096941 16_KI270728v1_random:1267110-1267132 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1142682376 17:1557756-1557778 CCCTCCTTTTACGAAGGGCAGGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG + Exonic
1147660008 17:42112393-42112415 GCTCCATTCTGGGAATGGCAGGG + Intronic
1148864649 17:50622254-50622276 GCTCCAAGTGAAGAAGGGCATGG - Intronic
1151385426 17:73752546-73752568 GTTCCATCTTAGGGAGGGCAGGG - Intergenic
1154132147 18:11746682-11746704 GCTCCATTTTATTAGGGGCTTGG + Intronic
1156008174 18:32468603-32468625 GATCCTTTTTATGAATGGCAGGG + Intronic
1156915868 18:42464126-42464148 GCTCCACATTAAGAAGGGGACGG - Intergenic
1157769465 18:50333040-50333062 ACTCAATTTTATGAAGGACAAGG - Intergenic
1159033493 18:63255120-63255142 CCTCCATTTTACTGATGGCATGG + Intronic
1160400290 18:78605673-78605695 GCTACATTTTAAGAACTGCACGG + Intergenic
1162393587 19:10403912-10403934 GTCCCCGTTTACGAAGGGCAGGG - Intronic
1163285234 19:16342717-16342739 GTGCCATTGTACGAAGGTCATGG - Intergenic
927254644 2:21029650-21029672 GCTCCATTTTCCGCAGAGCCTGG + Exonic
930345387 2:50173750-50173772 AGGCCATTTTACGAAGGGCGTGG + Intronic
938421596 2:131151526-131151548 GCTCCATGTCACGGAAGGCAGGG + Intronic
942252942 2:174063243-174063265 GCTCTATTCTACGAAAGGGATGG + Intergenic
1168975524 20:1962781-1962803 GCTGGATCTTAGGAAGGGCAGGG - Intergenic
1175086211 20:56461299-56461321 GCTCCATGATAAGCAGGGCATGG + Intergenic
1176055524 20:63144476-63144498 CCTCCGTGTCACGAAGGGCATGG - Intergenic
1176306548 21:5126561-5126583 GCTCCATCTCCCCAAGGGCAAGG + Intronic
1177331835 21:19674520-19674542 TCTCTATTTTATAAAGGGCAAGG - Intergenic
1179850511 21:44135469-44135491 GCTCCATCTCCCCAAGGGCAAGG - Intronic
1182320864 22:29478042-29478064 GCTCCAGTTTGCAGAGGGCAAGG - Intergenic
949809740 3:7993303-7993325 GCTTCATTTTACAAAGAACAGGG + Intergenic
949947459 3:9201937-9201959 TTTGCATTTTACGAATGGCAAGG + Intronic
956295075 3:67703520-67703542 GGTCCATTTTCAGAAGGGAATGG - Intergenic
957269262 3:78008005-78008027 TCTACATTTTACTAAGGGAAAGG - Intergenic
960150041 3:114239969-114239991 GCTGCATTTTGGGAAGGGGAGGG - Intergenic
962007758 3:131364246-131364268 GCTCTTTTTTTGGAAGGGCAGGG - Intergenic
973642714 4:52919041-52919063 ACTCCATTTTCCAAAGGCCATGG + Intronic
982971474 4:161993256-161993278 GCTCCATTTTAAAAATGACAAGG + Intronic
983262779 4:165474972-165474994 GGTGCATGTTAAGAAGGGCATGG + Intronic
997770573 5:136549479-136549501 CCTCCATATTAAGAAGGGGATGG + Intergenic
999967605 5:156826281-156826303 GCTCCACTTAATGAAGTGCAGGG - Intergenic
1003546273 6:7061612-7061634 GTTCCATTTTAGGCCGGGCACGG - Intergenic
1004613696 6:17269564-17269586 GCTCCATCATGAGAAGGGCATGG + Intergenic
1007898840 6:45391255-45391277 GCTCACTTTTACCAAGGGGATGG - Intronic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1010823931 6:80450220-80450242 ACTTCATTTTAGGAAGGGCTGGG - Intergenic
1012188163 6:96247644-96247666 GCTCCTTTGTACGTAGGGCTTGG - Intergenic
1012996738 6:105982299-105982321 TCTCCATAGTTCGAAGGGCAGGG - Intergenic
1021477504 7:21079502-21079524 CCTCCACTCTACCAAGGGCAAGG - Intergenic
1022070609 7:26909922-26909944 GCTCTATTTTAAGTAGGGTATGG + Intronic
1028168670 7:87569040-87569062 TCTCCATTTTCGGCAGGGCATGG + Intronic
1031364700 7:120888772-120888794 CCTCCATATTAAGAAGGGGATGG + Intergenic
1033407617 7:141085695-141085717 GCTCCATTTCCCCAAGGGCCTGG + Intronic
1037817460 8:22119781-22119803 GCTCCAGTGGACGCAGGGCAAGG + Exonic
1047393545 8:124474146-124474168 GCCGCATTTTACTAATGGCAAGG - Intergenic
1050427898 9:5530859-5530881 TCTGCATTTTAAGAAGGTCACGG - Intronic
1053584067 9:39437776-39437798 GCTCCATTTCATGCATGGCAGGG + Intergenic
1054105648 9:60996520-60996542 GCTCCATTTCATGCATGGCAGGG + Intergenic
1059097605 9:111435538-111435560 GTTCCATTTTCTGAAAGGCATGG - Intronic
1060603763 9:124896121-124896143 GCTCCATCTCAGGCAGGGCATGG + Intronic
1061479933 9:130892640-130892662 GCTCCATCTCCCGAAAGGCAAGG + Intergenic
1061873802 9:133534280-133534302 GCTCCGTTGTACGGAGGGAAAGG - Intronic
1062597170 9:137304602-137304624 GCTCCATTTGAGGATGGGAAGGG + Intergenic
1190411359 X:50140206-50140228 TCTCCAGGGTACGAAGGGCATGG - Intergenic
1197462616 X:126761279-126761301 GATACATTTTACAAAGGACAAGG - Intergenic