ID: 1132461355

View in Genome Browser
Species Human (GRCh38)
Location 16:56721-56743
Sequence GCCCCAAGGAAGCTCCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132461355_1132461369 18 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461369 16:56762-56784 GGCAGGCAGAGGGCAGCTGGAGG 0: 1
1: 0
2: 11
3: 122
4: 1147
1132461355_1132461366 7 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461366 16:56751-56773 ACTAGGAGAATGGCAGGCAGAGG 0: 1
1: 0
2: 2
3: 43
4: 461
1132461355_1132461367 8 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461367 16:56752-56774 CTAGGAGAATGGCAGGCAGAGGG 0: 1
1: 0
2: 3
3: 49
4: 391
1132461355_1132461359 -3 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461359 16:56741-56763 GGCCCTCCCCACTAGGAGAATGG 0: 1
1: 0
2: 0
3: 10
4: 124
1132461355_1132461370 19 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461370 16:56763-56785 GCAGGCAGAGGGCAGCTGGAGGG 0: 1
1: 3
2: 24
3: 90
4: 823
1132461355_1132461362 1 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461362 16:56745-56767 CTCCCCACTAGGAGAATGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1132461355_1132461371 20 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461371 16:56764-56786 CAGGCAGAGGGCAGCTGGAGGGG 0: 1
1: 0
2: 17
3: 136
4: 1386
1132461355_1132461357 -10 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461357 16:56734-56756 TCCTTGGGGCCCTCCCCACTAGG 0: 1
1: 2
2: 3
3: 27
4: 192
1132461355_1132461368 15 Left 1132461355 16:56721-56743 CCTCCAAGGAGCTTCCTTGGGGC 0: 1
1: 0
2: 4
3: 12
4: 158
Right 1132461368 16:56759-56781 AATGGCAGGCAGAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 69
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132461355 Original CRISPR GCCCCAAGGAAGCTCCTTGG AGG (reversed) Intronic
900829835 1:4958126-4958148 GCCCCCAGGAACTTCCTTGTGGG + Intergenic
903647683 1:24904830-24904852 GCTCCAAGGAAGCTGCTGGGGGG - Intronic
905233412 1:36529593-36529615 CCCCTTAGGAAGCTCCTTGAGGG + Intergenic
905369802 1:37476903-37476925 GCCCTGAGGGAGCTCCTAGGTGG + Intronic
906748304 1:48236868-48236890 GCAGCAGGGAAGCTACTTGGGGG + Intronic
907818745 1:57946163-57946185 GCCTCAAGGAATCTCCATGCTGG - Intronic
907820049 1:57958446-57958468 GCTAAAAGAAAGCTCCTTGGAGG - Intronic
909100198 1:71340386-71340408 GCCCTAAGGAAACTCCTTTAAGG - Intergenic
910927660 1:92413059-92413081 TCCCCAAGGCAGTTCCCTGGGGG - Intergenic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917970213 1:180201399-180201421 GTGCCAAGGAAGCTCCAGGGTGG + Exonic
919101613 1:193103968-193103990 GCCCTAAGGAAGAGCATTGGTGG + Intronic
922084715 1:222335287-222335309 TCCCCAAGGAAATTCCTTGTGGG - Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067720257 10:48722792-48722814 GACCCCAGGAAGCTCCTGGCAGG + Intronic
1067758312 10:49023904-49023926 GCCTCAAGGAAACTGCTTGAAGG + Intronic
1069753674 10:70760729-70760751 GCCCCAAGGCAGCCCCCCGGGGG - Exonic
1070609399 10:77923085-77923107 CCATCAAGGAAGCTCCTAGGTGG + Intronic
1072723673 10:97797793-97797815 GCTACAAGGAAACCCCTTGGAGG + Intergenic
1072925098 10:99610340-99610362 GCCCCAAGCAATCTCCCTGATGG - Intergenic
1073533467 10:104254304-104254326 TCCCCAAGGAAATTCCTTGTTGG - Intronic
1075026933 10:118992308-118992330 GCCACAAGGAATTTCCTTGCAGG + Intergenic
1077854762 11:6112692-6112714 ACCCCCAGGAAGCTACTGGGGGG + Intergenic
1078604943 11:12766935-12766957 TCCCCAAGGCAGCTGCCTGGAGG - Intronic
1079014430 11:16856609-16856631 CTCCCAGGGCAGCTCCTTGGTGG - Intronic
1082810788 11:57477638-57477660 GCCACCAGGAAGCTCTTTGATGG - Intergenic
1084729396 11:71063861-71063883 GCCCCAGGAACGCTCCTTCGTGG - Intronic
1089964782 11:122647025-122647047 GCCCTAAGGAAGCTCCTAGGAGG + Intergenic
1092109385 12:5948273-5948295 GCCTCAAACAAGCCCCTTGGTGG - Intergenic
1094475513 12:30837732-30837754 GCCACCAGGAGGCTCCTCGGGGG - Intergenic
1094503242 12:31038570-31038592 GCCACCTGGAAGCTCCTTGGAGG - Intergenic
1094745835 12:33343266-33343288 GCCACAAGGAATTTCCTTGTGGG + Intergenic
1100806083 12:98285162-98285184 GTCCCAAGGAAAGTCCTTGTAGG + Intergenic
1112406521 13:99125509-99125531 CCAGCAAGGCAGCTCCTTGGAGG - Intergenic
1116757740 14:48968832-48968854 GCTCAAAAGAAGCTCCTTGAAGG + Intergenic
1120483336 14:85080333-85080355 GCTCCAAGGTAACTCCTGGGTGG + Intergenic
1121278412 14:92683243-92683265 AGCCCAAGGAAGCACCATGGAGG + Intronic
1122805017 14:104252215-104252237 GCCCCAGGGCAGCTGTTTGGGGG - Intergenic
1122969404 14:105146435-105146457 CCCACACGGAAGCTCCTGGGTGG - Exonic
1123121434 14:105918756-105918778 GCCTGAAGGGAGCTCCATGGAGG + Intronic
1123404149 15:20010421-20010443 GCCTGAAGGGAGCTCCATGGAGG + Intergenic
1123513487 15:21017067-21017089 GCCTGAAGGGAGCTCCATGGAGG + Intergenic
1124949622 15:34305153-34305175 GCTCCAAGGATTCACCTTGGAGG - Intronic
1127383619 15:58450116-58450138 TCCTTAAGTAAGCTCCTTGGGGG - Intronic
1128866490 15:71118511-71118533 GGCCCAAGGAGGCTGCTCGGGGG - Intronic
1129915455 15:79266094-79266116 GCCCAAAGGAAGCATCCTGGAGG + Intergenic
1130732757 15:86516228-86516250 TCCACAAGGAATCTCCTTGTTGG + Intronic
1131516206 15:93078875-93078897 ACCCCAAGGATCCTCCTTTGTGG + Intronic
1132461355 16:56721-56743 GCCCCAAGGAAGCTCCTTGGAGG - Intronic
1132554522 16:566677-566699 GACCCAAGGACCCTGCTTGGGGG + Intergenic
1134221094 16:12354673-12354695 GCCCAGAGGAAGCTCGTGGGGGG + Intronic
1136059489 16:27716705-27716727 AGCCCAAGGGAACTCCTTGGTGG - Intronic
1137539586 16:49353144-49353166 GCTCCCTGGAAGCTTCTTGGGGG - Intergenic
1137675030 16:50299898-50299920 GCCCCAAGGAAGCTCTCCCGTGG + Intronic
1138072008 16:54001939-54001961 GCCCAAAGGAAGCCCCTTCTGGG - Intronic
1142320624 16:89380464-89380486 GCCCCAAGGAAGCTATCTGAAGG - Intronic
1142490249 17:273947-273969 GCCATAAGAAAGCTTCTTGGAGG - Intronic
1143680970 17:8475872-8475894 GCTCCAGGGAAGCTCCTTCAAGG + Exonic
1143706050 17:8698331-8698353 GGCTCAAGGAAGCTTCTGGGAGG + Intergenic
1145065288 17:19757689-19757711 GCCCCATGGAAGGTACTTGGCGG - Intergenic
1146263995 17:31439028-31439050 GCCCCCAGGAAGCTCAGTGCAGG - Intronic
1146297255 17:31659588-31659610 CACTCAAGGAAGCTCCTTGAAGG - Intergenic
1148445283 17:47733653-47733675 GCTCCAAGGAAGCGGCTCGGCGG - Exonic
1150209902 17:63436214-63436236 GCAGCAAGGAGGCACCTTGGTGG + Intronic
1151306814 17:73267845-73267867 GCCCCAAGAATGCCACTTGGAGG + Intergenic
1151854780 17:76713074-76713096 GCCCCAGTGAACCTCCTGGGAGG - Exonic
1152467398 17:80474032-80474054 GCTCCAAGGAAGGGCCTTGGAGG - Intronic
1154374689 18:13799286-13799308 CCCCGAAGGCAGCTCCCTGGGGG - Intergenic
1156630032 18:38956206-38956228 GCACCAAGGTAGATCCATGGAGG - Intergenic
1156655912 18:39285727-39285749 GCCATAAGGTAGCTCCTTAGGGG + Intergenic
1157424128 18:47570530-47570552 CCCTCAAGGAAGGTCCTTGCTGG + Intergenic
1157622333 18:49023819-49023841 GACAGAAGGGAGCTCCTTGGGGG - Intergenic
1158332873 18:56382185-56382207 AGCCCAAGGAAGCTTTTTGGGGG + Intergenic
1158993661 18:62895196-62895218 GCCCCAGGGAAGCTGCATTGGGG + Intronic
1161717094 19:5882284-5882306 GCCCCAGGCCAGCTCCTTGGTGG - Intronic
1161979124 19:7621386-7621408 GCCCCAAGGGAGTTCCTGGCAGG - Intronic
1163112931 19:15172351-15172373 GCCCCCAGGTATCTCCTTGGAGG + Intronic
1163629895 19:18412947-18412969 GACCCCAGGAAGCTCCTGGTAGG + Intergenic
1163737328 19:18989618-18989640 GCCCCAAGGAAGCTCCAGGGAGG + Intergenic
1165294520 19:34915936-34915958 ACCACAAGGAATGTCCTTGGAGG + Intergenic
1165689921 19:37855366-37855388 GCCTCGCGGAAGCTCCTGGGCGG - Intergenic
1166055152 19:40284189-40284211 CCCCCAGGGAAGCTCTCTGGGGG - Intronic
1166512722 19:43420561-43420583 GCCACAAGGAAATTCCTTGTGGG + Intergenic
1167603231 19:50466526-50466548 GCCCCAGAGAAGCTGCTGGGAGG + Intergenic
925179639 2:1808724-1808746 GCCCCAAAGCTGCTCCTGGGTGG + Intronic
925731335 2:6921312-6921334 GACAAAAGCAAGCTCCTTGGTGG + Intronic
927497982 2:23563431-23563453 GCCCCAAGGGGGCTCCTGGGAGG - Intronic
931200924 2:60096678-60096700 CCCCCAGGGAAGCTGTTTGGGGG - Intergenic
932461091 2:71882555-71882577 GCCCCATCCAAGCTCCCTGGAGG - Intergenic
934108229 2:88716024-88716046 TCCACAAGGAAGTTCCTTGTGGG - Intronic
934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG + Intergenic
934818777 2:97353938-97353960 GCCCCAAGGAACCTGCTGGCGGG + Intergenic
935675733 2:105593821-105593843 GCCCCAGGCAAGCTCCCTGCTGG + Intergenic
940036973 2:149321187-149321209 ACCCCAGGGAAGCTCCTGGTGGG + Intergenic
940601951 2:155874051-155874073 GCCCCAAGCAAGCCACCTGGAGG + Intergenic
941165136 2:162075707-162075729 GCCCCAAGGAAGCTGGCAGGAGG + Intergenic
941444442 2:165583091-165583113 GCCCCATGGAAACACCTTGTGGG + Intronic
945823856 2:214697000-214697022 CACCCAAGCAAGCTGCTTGGAGG + Intergenic
947791718 2:232872583-232872605 ACCCCAAGAAAGTTCCATGGCGG - Intronic
947916187 2:233833241-233833263 ACCCCAAGGAATGTCCTAGGTGG + Exonic
948798660 2:240420230-240420252 GTCCCAAGGAAGCTTGATGGGGG + Intergenic
948886846 2:240888918-240888940 CCCCCAAGGGAGGTCCTGGGGGG - Intronic
1169056227 20:2623896-2623918 GCCCAAAGGAAGCTCCATGTTGG + Intronic
1173255315 20:41390447-41390469 GCCCAAGGGGAGTTCCTTGGGGG - Intergenic
1174321093 20:49742183-49742205 CCTCCAGGGAAGCTCCCTGGAGG - Intergenic
1176349592 21:5781947-5781969 GCTCCATGGAAGCTGTTTGGGGG + Intergenic
1176356406 21:5902531-5902553 GCTCCATGGAAGCTGTTTGGGGG + Intergenic
1176543913 21:8180017-8180039 GCTCCATGGAAGCTGTTTGGGGG + Intergenic
1176562864 21:8363062-8363084 GCTCCATGGAAGCTGTTTGGGGG + Intergenic
1178953958 21:37006828-37006850 GCCCCGGGGACGCTCCCTGGAGG + Exonic
1181345729 22:22219430-22219452 GCCCCACGGAAGGACCTGGGAGG - Intergenic
1181542454 22:23580563-23580585 GCCCCAAGGGAGGGTCTTGGGGG - Intergenic
1181934344 22:26428532-26428554 GCCCCAAGGAGGCTGCTTGGAGG - Intergenic
1183465363 22:37977710-37977732 GCCCAGAGGGAGCTCCATGGGGG - Intronic
1184225698 22:43127880-43127902 GCCCTGAGGAAGCTCTGTGGGGG + Intronic
1184412937 22:44336380-44336402 GCCCCAAAGAAGCTCACTGTCGG + Intergenic
1184761955 22:46549922-46549944 CCACCAAAGAAGCTCCTGGGTGG - Intergenic
1184797368 22:46739839-46739861 CCCCCAACGGAGCTCCTTCGGGG - Intergenic
950053246 3:10007742-10007764 CCCACAAGGAAGCTCCTTGATGG - Intronic
950652461 3:14415836-14415858 GCCTCAGAGAAGATCCTTGGGGG - Intronic
956451439 3:69378924-69378946 GGACCAAGGAAGCTTCCTGGAGG - Intronic
959735733 3:109655532-109655554 GCCCCAAGGCAGCATCTAGGAGG - Intergenic
960973947 3:123157743-123157765 TCCCCAAGTAAGCTCCCGGGAGG - Intronic
961786124 3:129347908-129347930 CCCACAAGGAAGCTCCCTGAGGG - Intergenic
972642697 4:40940117-40940139 CCCACTAGGAAGCTCCTTGGTGG - Intronic
973343617 4:49031061-49031083 GCCCCAGTGATGCTTCTTGGGGG + Intronic
976537367 4:86233493-86233515 TTTCAAAGGAAGCTCCTTGGGGG - Intronic
979122846 4:116926001-116926023 GCCCCAGGTAATCTCCATGGAGG - Intergenic
979205649 4:118033905-118033927 GCCCCAGGTAATCTCCATGGAGG + Intronic
985186156 4:187318101-187318123 GCCCCAACAAAGTGCCTTGGTGG + Intergenic
986038604 5:3964553-3964575 GAGCCCAGGAAGCTCCTTTGAGG - Intergenic
988738575 5:34047105-34047127 GCCCCAGGCAACCTCCCTGGAGG + Intronic
988787310 5:34576955-34576977 GCCCCGCTGAAGCTCCATGGTGG - Intergenic
992541973 5:77775023-77775045 CCCCCAAGGAAATTCCTTGTGGG + Intronic
992541972 5:77775023-77775045 CCCACAAGGAATTTCCTTGGGGG - Intronic
996551322 5:124733444-124733466 GCCCCAATTAAGCACCCTGGGGG + Intronic
996768557 5:127060772-127060794 GCCTCATGTAATCTCCTTGGAGG + Intronic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1002494655 5:179603513-179603535 ACCCCCAGGGAGCTCCTTGAGGG + Intronic
1002524467 5:179807361-179807383 GCCCAGAGGAAGCTCCTGAGCGG - Intronic
1005648350 6:27864050-27864072 GCTCCAAGTGAGCTCCTTGCTGG - Intronic
1007319436 6:41016626-41016648 TCGCAAAGGAAGCTCCTTGGAGG - Intergenic
1007957270 6:45929348-45929370 GCCCCAAGGACCCTCCATGAGGG + Intronic
1013871445 6:114766655-114766677 CCCCTAAGGAAACTCCTTGTGGG - Intergenic
1014323136 6:119957259-119957281 GCCCTAAGGAATCTTCTTTGTGG - Intergenic
1019073858 6:169371173-169371195 TACCCAAGGCAGCACCTTGGAGG - Intergenic
1019347090 7:536363-536385 GTCCCTAGGGAGCTCCTAGGAGG + Intergenic
1020044190 7:5028165-5028187 GCCCCATGGAACATCCTTGAGGG - Intronic
1023343640 7:39248952-39248974 GGCCTGAGAAAGCTCCTTGGGGG - Intronic
1023929408 7:44696145-44696167 GCCACAAATAAGCTCCTTTGAGG + Intronic
1024616795 7:51122288-51122310 GCTGCAAGGATCCTCCTTGGTGG - Intronic
1026291631 7:69011753-69011775 GTCCCAAGGAATTTCCTTGTGGG + Intergenic
1029222935 7:99004470-99004492 GCCCCATGGGAGCTCCAGGGTGG + Intronic
1035759909 8:2061633-2061655 GCCCCATGCAGGCTCCTGGGAGG - Intronic
1035930778 8:3777646-3777668 ACTTCAAGGAGGCTCCTTGGAGG - Intronic
1036643887 8:10600522-10600544 TCACCACGGAAGCTCCTTGTTGG - Intergenic
1037952769 8:23029499-23029521 GCCTCAAGGATGCCCCTTGCGGG + Intronic
1039248491 8:35635252-35635274 GCACCAAGGCACCTCCTTTGGGG + Intronic
1042290320 8:67164116-67164138 GGCCCAAGGAAGTTCCTTTACGG - Intronic
1045284345 8:100777497-100777519 ACCCACAGGAAGGTCCTTGGAGG + Intergenic
1051756532 9:20406905-20406927 GACCTAAGGAAGCTGCTTAGGGG + Intronic
1056249470 9:84733164-84733186 GTTCCATGGAAGCCCCTTGGTGG + Intronic
1057624601 9:96666392-96666414 CCCCCCAAGAAGTTCCTTGGTGG + Intergenic
1060406861 9:123377118-123377140 GACCCAAGGAAGCTGCTTCCAGG + Exonic
1060600645 9:124875305-124875327 CTCCCAAGGAAGCTCCTGGTAGG + Intronic
1061183021 9:129036322-129036344 ACTCCAAGAAAGCCCCTTGGAGG + Intergenic
1061857763 9:133452042-133452064 GCCTCCAGGTGGCTCCTTGGTGG + Intronic
1061991582 9:134162258-134162280 ACCCTAAGGTAGCTCCTTGCTGG - Intergenic
1062395201 9:136349989-136350011 GTCCCCAGGAGGCTCCTCGGTGG - Intronic
1189160745 X:38805705-38805727 GGCCCAAGGAACCTCCTGGGAGG + Exonic
1190357387 X:49618405-49618427 GCCCCCAGGAAGGTCCTTCTGGG - Intergenic
1192195179 X:69023168-69023190 ACTCAAAGGAAGCTCCTTGATGG + Intergenic
1195320857 X:103720992-103721014 ACCCCAAGGGGGCTCCTGGGTGG - Intronic
1199077295 X:143537846-143537868 GCCCCAAGAATACTCATTGGTGG + Intergenic
1200048034 X:153412930-153412952 GCTGCAAGGAAGCTCCTCAGAGG + Intergenic