ID: 1132461360

View in Genome Browser
Species Human (GRCh38)
Location 16:56743-56765
Sequence TGCCATTCTCCTAGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132461360_1132461369 -4 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461369 16:56762-56784 GGCAGGCAGAGGGCAGCTGGAGG 0: 1
1: 0
2: 11
3: 122
4: 1147
1132461360_1132461375 30 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461375 16:56796-56818 TTCCCACCAGTGGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132461360_1132461372 20 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461372 16:56786-56808 GCCTTGCTGCTTCCCACCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 231
1132461360_1132461370 -3 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461370 16:56763-56785 GCAGGCAGAGGGCAGCTGGAGGG 0: 1
1: 3
2: 24
3: 90
4: 823
1132461360_1132461371 -2 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461371 16:56764-56786 CAGGCAGAGGGCAGCTGGAGGGG 0: 1
1: 0
2: 17
3: 136
4: 1386
1132461360_1132461368 -7 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461368 16:56759-56781 AATGGCAGGCAGAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 69
4: 559
1132461360_1132461374 29 Left 1132461360 16:56743-56765 CCCTCCCCACTAGGAGAATGGCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1132461374 16:56795-56817 CTTCCCACCAGTGGCAGCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132461360 Original CRISPR TGCCATTCTCCTAGTGGGGA GGG (reversed) Intronic
901636612 1:10673499-10673521 TGCCTCTCTCCTGCTGGGGAGGG + Intronic
901796882 1:11684687-11684709 TGCCATCAGCCTGGTGGGGATGG - Intronic
902991181 1:20187992-20188014 AGCCATTCCACAAGTGGGGAGGG + Intronic
907519129 1:55011849-55011871 TGCCCCTCTCCCAGTGGAGAGGG - Intergenic
919820660 1:201469783-201469805 TGCCCTCCTCGTAGTGGGGGAGG + Intergenic
922892547 1:229072856-229072878 AGTCCTTCTCCTTGTGGGGAGGG - Intergenic
1063441879 10:6079392-6079414 TTCCTTCCTCCTGGTGGGGAGGG - Intergenic
1063710723 10:8475554-8475576 TTCCCTTCTCCCAGTGGGAAGGG + Intergenic
1065475151 10:26128377-26128399 TTCAATTCTTCTAGTGGGAATGG + Exonic
1066708026 10:38202379-38202401 TGCAACACTCCTATTGGGGATGG - Intergenic
1068119263 10:52769815-52769837 GCCCATTATCCAAGTGGGGAGGG + Intronic
1069890852 10:71651730-71651752 TGCTGTTCTGATAGTGGGGAAGG + Intronic
1069954098 10:72039290-72039312 TGCCATTCTCCAGGCGGGGATGG - Intergenic
1070440211 10:76435709-76435731 TGCCATGCTCATAGAGGGGTTGG + Intronic
1071175222 10:82918330-82918352 TGACAGTCTTCTAGTGAGGATGG - Intronic
1071605099 10:86980446-86980468 TCCTCTTGTCCTAGTGGGGATGG + Intronic
1072479605 10:95797941-95797963 TGCCATCCTCATAGTGAGTAGGG + Intronic
1074394821 10:113089120-113089142 CACCATTCTCCTAATGGGCATGG - Intronic
1076775582 10:132696138-132696160 TGTCTTTCTCCTAGTTTGGAGGG - Intronic
1077024778 11:434200-434222 TGCTGTTCTCCTTGTGGGGAGGG - Intronic
1077483821 11:2829921-2829943 TGCCAATACCCTGGTGGGGAGGG + Intronic
1078105874 11:8357675-8357697 CAGCCTTCTCCTAGTGGGGAGGG - Intergenic
1079744061 11:24102232-24102254 TCACATTCTCCTAGGGAGGAAGG + Intergenic
1081045302 11:38266803-38266825 TGCTATTCTCCTAATAGTGAGGG + Intergenic
1083120087 11:60503688-60503710 TGCCTTTCACCTAATGGAGATGG - Exonic
1088152377 11:106759973-106759995 TGGCATTCTCCCTGTGGGCATGG - Intronic
1088577411 11:111285277-111285299 TGCCATTTACACAGTGGGGAAGG - Intronic
1088653631 11:111978540-111978562 TGCCACTCCCCCAGCGGGGATGG + Intronic
1089814465 11:121160122-121160144 TGCCATTCACCTATTGGAGGAGG - Exonic
1090495292 11:127205877-127205899 TGCCTGTCTTCTAGTGGTGAAGG - Intergenic
1090974871 11:131672184-131672206 TGCTCTGCTCCTGGTGGGGAGGG - Intronic
1091544569 12:1492878-1492900 TGCCCCTCTCCTAGTGGTCATGG + Exonic
1091698442 12:2643666-2643688 TGCATTTCTCCTGGTGGGAAGGG + Intronic
1092160318 12:6312107-6312129 TGCCATTCACTGATTGGGGATGG + Intronic
1092767936 12:11869946-11869968 TGCTATTCTCCCAATGGGCATGG - Exonic
1094372352 12:29751781-29751803 TCCCATTCTCCCGGTGAGGATGG + Exonic
1099231310 12:80028806-80028828 TGCCAATATTCTAGTGGGAAGGG - Intergenic
1099786420 12:87269726-87269748 TGCCATTCTCATGGTAGTGAGGG - Intergenic
1100060833 12:90574035-90574057 TGCCATTCTCCTGGTTTGTAAGG + Intergenic
1102418609 12:112786297-112786319 TGCCCTTTTCCTTGTGGGAAGGG + Intronic
1104636636 12:130441777-130441799 TGTCACCCTGCTAGTGGGGAGGG - Intronic
1105224925 13:18423493-18423515 TCCCATTCTCCTCTGGGGGAGGG + Intergenic
1105895798 13:24716616-24716638 GGCCATTCTGCTATTGGGCAGGG + Intergenic
1107877322 13:44802259-44802281 AGCCTTTCTCCTACTAGGGAAGG - Intergenic
1108999358 13:56778387-56778409 TGCCAGACTGCTAGTGGGGCAGG - Intergenic
1113818567 13:113194102-113194124 TGACATCCACCTGGTGGGGAGGG + Intronic
1114009031 14:18347860-18347882 TCCCATTCTCCTCTGGGGGAGGG + Intergenic
1115302489 14:31900292-31900314 TGCCATTCTCTTAGCGTGGAAGG + Intergenic
1123023677 14:105413671-105413693 AGCCAGTCTCCTGGTGGGTAAGG + Exonic
1123113178 14:105882388-105882410 TGCCAGCCTCCTAGAGGGTATGG - Intergenic
1123115528 14:105892540-105892562 TGCCAGCCTCCTAGAGGGTATGG - Intergenic
1123119773 14:105911256-105911278 TGCCAGCCTCCTAGAGGGTATGG - Intergenic
1124401160 15:29348701-29348723 GGCCATTTTCCTACTGGGGCTGG - Intronic
1128748338 15:70130682-70130704 TTCCCTTCTCCTAGTTGGCAGGG - Intergenic
1129342048 15:74892550-74892572 TGCCATCCTGCAACTGGGGAGGG + Intronic
1130016932 15:80194880-80194902 TGTGATTCTCCTATTGGAGATGG - Intergenic
1131129625 15:89888754-89888776 TGCCATTCACCTAGTAAGAATGG - Intronic
1132461360 16:56743-56765 TGCCATTCTCCTAGTGGGGAGGG - Intronic
1132548843 16:545933-545955 TGCCCTTCTCCGAGTGGTGATGG + Intronic
1139481577 16:67233825-67233847 TGTCTTCCTCTTAGTGGGGAGGG + Exonic
1140525580 16:75620102-75620124 TTCCATTCTCCAAGTGAGTACGG + Intronic
1141946847 16:87316630-87316652 TGCTATATTCCTGGTGGGGAGGG + Intronic
1143846716 17:9777713-9777735 TTCAATTCTCCTAGTATGGAAGG + Intronic
1145241621 17:21243677-21243699 TGCAATTCTCCTGGCGGGGTGGG + Intronic
1149268475 17:54952888-54952910 TCCCATTCTCCTTTTGGGAAGGG - Intronic
1149527936 17:57371997-57372019 TACCATTCTCCTTATCGGGAGGG - Intronic
1151341275 17:73472451-73472473 TGCCCTTCTCCAAGCAGGGAAGG + Intronic
1153706213 18:7748372-7748394 TGCCAAGCTCCTTGTGAGGAGGG + Intronic
1154528438 18:15316029-15316051 TCCCATTCTCCTCTGGGGGAGGG - Intergenic
1154929671 18:20979812-20979834 TGCCATTATTCTGGTGGGAATGG - Intronic
1161051983 19:2168944-2168966 TGCCCTTCTTCTAGTGGGAAGGG + Intronic
1164408366 19:27975408-27975430 TGCAACACTCCTAATGGGGAGGG - Intergenic
1165441358 19:35830127-35830149 TGCAATTCTGCTACTGTGGAAGG - Intronic
1167907098 19:52670346-52670368 TGTCATTCCCCTATTGGCGAGGG - Intronic
927707600 2:25306451-25306473 GGCCACTCTCCTGGAGGGGAGGG + Intronic
927992554 2:27458343-27458365 TGCCACTCTACTAGTGAGGTTGG + Intronic
928103252 2:28451881-28451903 TGGCATTGTCCCAGTGGGAATGG + Intergenic
928858279 2:35826608-35826630 CTCCATTCTTCTGGTGGGGAGGG - Intergenic
934739007 2:96705620-96705642 AGCCATTCTACTATTGTGGAGGG + Intergenic
936006931 2:108897458-108897480 AGTCATTTTCCTAGTGGGGAAGG - Intronic
938527545 2:132147492-132147514 TCCCATTCTCCTCTAGGGGAGGG - Intergenic
941930188 2:170930625-170930647 TGCCATACTCTTAGTAGGAAAGG + Intronic
942770090 2:179506785-179506807 TGCCTTTTTCCTAGAGAGGAAGG + Intronic
943390747 2:187264903-187264925 TCCCTTTTTTCTAGTGGGGACGG + Intergenic
946758561 2:222971274-222971296 CGCTAGTCACCTAGTGGGGAAGG - Intergenic
948164191 2:235848832-235848854 TGCTTTTCTGATAGTGGGGAAGG + Intronic
948865150 2:240771416-240771438 TGCCATGCTGCTGCTGGGGAGGG - Intronic
1170897316 20:20427391-20427413 TGCCATTCTGCTTGCGGGGTGGG + Intronic
1171460212 20:25293851-25293873 TGCCACATTCCTAGTGGAGAGGG - Intronic
1172217876 20:33249308-33249330 TGTCATTCTCCTGGTAGTGATGG - Intergenic
1173091364 20:39975149-39975171 TGCCAAGGTCCCAGTGGGGAGGG - Intergenic
1173337695 20:42126151-42126173 TCCCATTCTCCAGATGGGGAGGG - Intronic
1176768975 21:13052511-13052533 TCCCATTCTCCTCTGGGGGAGGG + Intergenic
1178115276 21:29410747-29410769 TTCCTTTCTCCTACTTGGGAGGG + Intronic
1180433531 22:15278670-15278692 TCCCATTCTCCTCTGGGGGAGGG + Intergenic
1180516090 22:16146579-16146601 TCCCATTCTCCTCTGGGGGAGGG + Intergenic
1183366929 22:37411795-37411817 TGCCAGGCTCCTGGAGGGGATGG - Intronic
950140871 3:10614162-10614184 TGACATTCTCCTAAGGGAGATGG - Intronic
952285984 3:31970234-31970256 TGGAATTTTCCTTGTGGGGAGGG - Intronic
954530561 3:51315204-51315226 AGCCATGATTCTAGTGGGGATGG + Intronic
962925056 3:139985261-139985283 TGCAAGTCTCCGAGTGGGGGTGG + Intronic
964381622 3:156103491-156103513 TGCCATTTTCCAGATGGGGATGG - Intronic
967411300 3:189169029-189169051 TGCCATTTTTCAAATGGGGATGG - Intronic
972936925 4:44147628-44147650 TCCCATTAGGCTAGTGGGGATGG - Intergenic
977969849 4:103200497-103200519 TGCTATTCTCTTAGAGGAGATGG + Intergenic
978878119 4:113666698-113666720 TGGGATTCTCTTTGTGGGGAAGG - Intronic
978963511 4:114713098-114713120 TGCCATTCTTCAAATGGGCATGG + Intergenic
980431292 4:132700293-132700315 TGAAATTCTGTTAGTGGGGATGG + Intergenic
981064760 4:140470840-140470862 TAGCATTGTCCTAGTGGTGATGG - Intronic
981217757 4:142191399-142191421 TACCATTCTTCTAGTGGGGGAGG - Intronic
982140890 4:152316820-152316842 TGCTACTCACCTAGAGGGGAAGG - Intergenic
982872780 4:160605114-160605136 TATCATTCTCCTAGTGGATAAGG - Intergenic
986142638 5:5045903-5045925 GTCCACTCTCCTACTGGGGAAGG - Intergenic
986282176 5:6332649-6332671 TGCCATTATCAAAGAGGGGAAGG - Intergenic
987898265 5:23977709-23977731 TCCCATTCTCCTATGGGGAAAGG + Intronic
990130286 5:52573828-52573850 TGCCATTCTCCCAAAGAGGAAGG - Intergenic
993054792 5:82969300-82969322 TGTCATTCTCCTATTGGCTAGGG + Intergenic
996046623 5:118881772-118881794 TGCCATTCTCATGATGGTGAGGG - Intronic
996708473 5:126520784-126520806 TGCCTTTCCCCTAGAGGGGAAGG - Intergenic
999341806 5:150779241-150779263 AGCCAGTCTCCGAGTGGGGCTGG - Intronic
999375451 5:151083430-151083452 TGCCATGCTCCTAGAGGCTAGGG - Intronic
1003248140 6:4401299-4401321 TGCCACTCTCCTCAAGGGGAGGG + Intergenic
1003933640 6:10953507-10953529 TCTAATTCTCCTAGTGGTGAGGG - Intronic
1003948894 6:11099735-11099757 TCCAGTTCTCCTAGTGGTGAGGG + Intronic
1005270317 6:24156776-24156798 TACAATCCTCCTAGTGGGCAGGG + Intergenic
1007065799 6:38989255-38989277 AGCAATTTTCCCAGTGGGGAAGG - Intronic
1007344035 6:41214876-41214898 TGTCATTCCCCTAGTGGCTAGGG + Intergenic
1008158855 6:48052377-48052399 TGTTATTCTTCTAGTGGAGAAGG - Intronic
1009424184 6:63496354-63496376 TGTCATTGTCCTAGTGGCTATGG - Intergenic
1011206238 6:84902409-84902431 TTCCATTCTGCAAGTGGGAATGG + Intergenic
1018191132 6:161309840-161309862 TGTCATTCTCCTATTGGCTAGGG + Intergenic
1019911051 7:4100741-4100763 TCACAGTCGCCTAGTGGGGAAGG + Intronic
1022236575 7:28467272-28467294 TGCCATTCTCTCAGTGAGGGAGG + Intronic
1022535155 7:31093884-31093906 AGCCATTCTCCTAGAGGGAGAGG + Intronic
1024534386 7:50418200-50418222 TGCCCTCCACCTAGTGGTGAAGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1027635620 7:80669136-80669158 TGCCACTCTACTGGTGGGGTAGG + Intronic
1031055685 7:116990826-116990848 TTCCATTCTCATTTTGGGGAGGG - Intronic
1033479693 7:141727571-141727593 TGCCAGTTTCCTTGTGGGCAGGG - Intronic
1034886678 7:154803742-154803764 TGCCATTCTCTCTGTGGGAAGGG - Intronic
1035530606 8:347596-347618 GCTCATCCTCCTAGTGGGGAAGG - Intergenic
1036104166 8:5822568-5822590 TGTCATTCCCCTATTGGGTACGG + Intergenic
1041123402 8:54609765-54609787 TGTCTTTCTGCTACTGGGGATGG + Intergenic
1044984155 8:97743169-97743191 TGCCTTTCAACTAGTGGGAATGG + Intergenic
1048845434 8:138600462-138600484 TGACATGCTCAGAGTGGGGAGGG + Intronic
1049417824 8:142503601-142503623 TGCCAGCCTCCTGCTGGGGAGGG + Intronic
1053706222 9:40754767-40754789 TCCCATTCTCCTCTGGGGGAGGG - Intergenic
1054416298 9:64878372-64878394 TCCCATTCTCCTCTGGGGGAGGG - Intergenic
1056927717 9:90848946-90848968 TGCCATTCCCTGGGTGGGGATGG - Intronic
1062145586 9:134988015-134988037 TGCCATTCCCAGGGTGGGGAAGG - Intergenic
1187667776 X:21633129-21633151 TGCCATTTTCCGGGAGGGGATGG - Intronic
1189316360 X:40059513-40059535 TGACACTCTCCTAGATGGGAGGG + Intronic
1192368740 X:70496476-70496498 TGCCCATCTCTTAGTGGTGAGGG - Intronic
1197626237 X:128805121-128805143 TGCCATTCTTCTAGTGGCTGTGG - Intergenic
1198314909 X:135455474-135455496 TGCCTATCTGCTGGTGGGGATGG - Intergenic
1199637195 X:149825324-149825346 TGTCATTCTCCTATTGGCTAGGG - Intergenic
1200283019 X:154794623-154794645 TGCCATTCACTGTGTGGGGAAGG + Intronic