ID: 1132461762

View in Genome Browser
Species Human (GRCh38)
Location 16:58912-58934
Sequence ACAGGTTCACAGCAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132461755_1132461762 23 Left 1132461755 16:58866-58888 CCGAGGATCCAACTGGAGATGCT 0: 1
1: 0
2: 1
3: 9
4: 390
Right 1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG 0: 1
1: 0
2: 4
3: 22
4: 208
1132461759_1132461762 -1 Left 1132461759 16:58890-58912 CCAGACTCAGTGCTCGATATGGA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG 0: 1
1: 0
2: 4
3: 22
4: 208
1132461757_1132461762 0 Left 1132461757 16:58889-58911 CCCAGACTCAGTGCTCGATATGG 0: 1
1: 0
2: 0
3: 5
4: 145
Right 1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG 0: 1
1: 0
2: 4
3: 22
4: 208
1132461756_1132461762 15 Left 1132461756 16:58874-58896 CCAACTGGAGATGCTCCCAGACT 0: 1
1: 0
2: 0
3: 19
4: 122
Right 1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG 0: 1
1: 0
2: 4
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132461762 Original CRISPR ACAGGTTCACAGCAGGCTGC AGG Intronic
900243287 1:1626801-1626823 AGGGGGTCACAGCAGGCTGCAGG - Intronic
900782435 1:4626789-4626811 ACAGGCAAACTGCAGGCTGCTGG + Intergenic
901323737 1:8355226-8355248 TCAGCTACACAGGAGGCTGCGGG - Intronic
902177561 1:14662272-14662294 ACAGGTCCAAAGGAGGCTGCTGG + Intronic
902925817 1:19695076-19695098 ACAGGCTCAGCCCAGGCTGCAGG + Intronic
903997836 1:27318869-27318891 ACAGGATCACAGCAGGGTCCTGG - Intergenic
907515375 1:54990370-54990392 GCAGCCTCACAGCAGCCTGCTGG - Intronic
912104234 1:106250737-106250759 AGTAGTTCACAGCAGGCAGCAGG - Intergenic
912339234 1:108894832-108894854 AAAGGTTCAAAGCAGACTTCTGG - Intronic
913021453 1:114792205-114792227 CCAGGTTGACATCAGACTGCTGG + Intergenic
916561559 1:165938057-165938079 TCAGATTGACAGCAGGCTCCTGG + Intergenic
916620069 1:166487443-166487465 ACAGGTTCCCAGGGGTCTGCTGG - Intergenic
917186170 1:172358650-172358672 GCTGGATCACAGCAGGCTTCTGG - Intronic
918356141 1:183707835-183707857 AGAGGTAGACAGCAGACTGCTGG + Intronic
919787403 1:201268583-201268605 GCAGGGTCCCTGCAGGCTGCTGG - Intergenic
922759885 1:228121708-228121730 ACAGTTTCAAAGCAGTTTGCAGG + Intergenic
922894700 1:229090921-229090943 ACAGGTGCACACCAGCATGCTGG - Intergenic
924650219 1:245919126-245919148 AAAGGTACACTGCAGGCAGCGGG - Intronic
1062766422 10:69285-69307 ACAGGGACACAGCAGCCTCCTGG + Intergenic
1063078765 10:2744407-2744429 ACAGGTTAACATAAGGTTGCTGG + Intergenic
1064101882 10:12471182-12471204 ACATGTTCACTGCAGGCTGCAGG + Intronic
1064139578 10:12778986-12779008 ACAGGTGCAGAGCAGGCAGGGGG + Intronic
1068978287 10:63034507-63034529 AGAGGATAAAAGCAGGCTGCCGG + Intergenic
1069385584 10:67880741-67880763 ACAGGCGCAAAGCAGGATGCTGG + Intergenic
1070288285 10:75099292-75099314 ACAGGCACCCAGGAGGCTGCCGG + Intronic
1070351004 10:75592165-75592187 ACAGGTTCAAAGCAGGGAGGAGG + Intronic
1070775964 10:79109974-79109996 AAAGGTTCAGTGAAGGCTGCAGG + Intronic
1073044909 10:100631344-100631366 ACAGGTTCAGAGAAGGGTGGTGG - Intergenic
1073589583 10:104743717-104743739 ACAGGTTCACAGGGGGCTTAGGG - Intronic
1074966530 10:118495620-118495642 ACTGGTTCCTTGCAGGCTGCTGG - Intergenic
1076801069 10:132828870-132828892 ACAGGTGCACAGCCGGGTGGTGG - Intronic
1077185966 11:1235502-1235524 ACAGGTTCTCAGCAGTGTCCTGG + Intronic
1079292659 11:19202161-19202183 AGAGGCTCACAGCTGGCTGGGGG - Intronic
1079784939 11:24659819-24659841 ACAGGTTTATATCAGGGTGCAGG - Intronic
1081524116 11:43912466-43912488 ACAGGTTCACAGGAAGCACCTGG - Intronic
1082816711 11:57514375-57514397 GCAGCTTCCTAGCAGGCTGCCGG + Intronic
1083769103 11:64856482-64856504 CCAGGTTCCCAGCTTGCTGCAGG - Intronic
1083792356 11:64994234-64994256 CCAGGTACACACCAGGCTCCAGG - Intronic
1084166663 11:67378007-67378029 CCAGCATCACAGCAGGCTGGAGG - Intronic
1085049782 11:73374417-73374439 TCAGGGTCAGAGCTGGCTGCAGG + Intergenic
1086945495 11:92840253-92840275 ACAGGTTCCGAGCATGGTGCTGG - Intronic
1090373153 11:126270804-126270826 ACATGTTCACAGCAGGGGGTAGG + Intronic
1090948137 11:131449457-131449479 AGGGGTGCACAGCAGGCTGGTGG + Intronic
1091140709 11:133232047-133232069 ACAAATTCACTGAAGGCTGCTGG + Intronic
1091347730 11:134866546-134866568 ACAGGATCACAGGGGGCAGCTGG - Intergenic
1091866519 12:3841909-3841931 ACATGTTCACTCCTGGCTGCTGG - Intronic
1096623733 12:52880203-52880225 GCAGGCTGACAGCAGGCTGCAGG + Intergenic
1096981836 12:55732578-55732600 ACATGCTCTCAGAAGGCTGCAGG - Intergenic
1102259680 12:111436484-111436506 CCATCCTCACAGCAGGCTGCAGG + Intronic
1103983167 12:124750019-124750041 ACAGGCACACTGCAGGCAGCGGG + Intergenic
1104769501 12:131352265-131352287 GCAGCTCCGCAGCAGGCTGCGGG + Intergenic
1104913333 12:132250886-132250908 ACAGGTCCACCGCAGGCCTCCGG - Intronic
1106197121 13:27503454-27503476 ATCTGTTCACAGCAGGCTGTTGG - Intergenic
1107442416 13:40440000-40440022 ACATGTTTACAGCAGCCAGCAGG + Intergenic
1108075599 13:46676144-46676166 TCAGCTACACAGCAGGCTGAGGG + Intronic
1108581902 13:51834903-51834925 CCAGGGTGGCAGCAGGCTGCAGG + Intergenic
1111507465 13:89212390-89212412 ACAGGATTCCAGCAGGTTGCTGG + Intergenic
1115956439 14:38785616-38785638 ACAGATTCACTGCAGCCAGCTGG - Intergenic
1117362387 14:54989772-54989794 ACAGCTACACAGGAGGCTGAGGG - Intronic
1122027101 14:98886046-98886068 ACAGGGTGACCACAGGCTGCAGG + Intergenic
1122398176 14:101450052-101450074 ACTGGTACAGAGCAGGCTCCCGG + Intergenic
1202896851 14_GL000194v1_random:15328-15350 CCAGGTGGACATCAGGCTGCAGG + Intergenic
1123999406 15:25742269-25742291 ACAGGTCCACAGGTGGCTTCTGG + Intronic
1124631220 15:31338730-31338752 CCAGGATCCCAGCAGGCTGCTGG - Intronic
1124902214 15:33834994-33835016 CCTGGCTCACAGCAGGCTGTGGG + Exonic
1127983886 15:64053331-64053353 CCAGGGGCACAGCAGGCTCCAGG + Intronic
1128718001 15:69923132-69923154 AAACGTTCAAAGCAGGCTTCTGG + Intergenic
1130320225 15:82835441-82835463 ACTGGTACACAGCAGCCTGAGGG + Exonic
1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG + Intronic
1132805626 16:1773792-1773814 TCGGGTCCACCGCAGGCTGCGGG - Exonic
1132834417 16:1945661-1945683 GGAGGTTCACAGCAGGGTGTGGG - Intronic
1133251979 16:4488454-4488476 ACAGTTTTACAGCAAACTGCTGG + Intronic
1134539778 16:15055498-15055520 CAACGTTCACCGCAGGCTGCGGG + Intronic
1137717952 16:50610514-50610536 CCAGGTCCAGAGCAGGCAGCTGG - Intronic
1138089633 16:54163613-54163635 ACAGGTGCACACCACCCTGCAGG - Intergenic
1139539540 16:67603986-67604008 ACAGGTTCATACCAGGCACCAGG - Intronic
1141035517 16:80622264-80622286 AGACGTTCAAAGAAGGCTGCAGG - Intronic
1142079514 16:88141582-88141604 AGAGGCACACAGCAGGCTCCGGG - Intergenic
1142375834 16:89706739-89706761 TGAGGTGCACAGAAGGCTGCCGG - Intergenic
1142412027 16:89921757-89921779 ACAGGCTCAATGGAGGCTGCAGG + Intronic
1142699521 17:1650529-1650551 AGCGGTTCACAGCAAGATGCTGG - Intergenic
1142893971 17:2962916-2962938 ACAGCTTCAGAGCAGGCTGGGGG + Intronic
1143117149 17:4587542-4587564 ACAGCCCCACACCAGGCTGCTGG + Intronic
1144641686 17:16940589-16940611 ACAGGCTCACAGCAGGGGGATGG - Intronic
1145347274 17:22049016-22049038 ACAGGTGAGCATCAGGCTGCAGG - Intergenic
1146483299 17:33222987-33223009 TCAGGTTCACATCAGGGAGCCGG + Intronic
1147361773 17:39935349-39935371 CCAGGGTCACAGCAGCCTGGAGG - Intergenic
1147425274 17:40343198-40343220 ACAGCTTCACAGCAGGCTGGAGG + Intronic
1148683027 17:49485624-49485646 ACAGGCAGACAGCAGGCTGCAGG - Intergenic
1148761145 17:50001261-50001283 AGCGGTTCACAGCTGGCTGAGGG + Intergenic
1151283405 17:73092782-73092804 TCTGGTTCACAGCCGTCTGCAGG + Intergenic
1151534216 17:74729615-74729637 CCAGGGACAAAGCAGGCTGCTGG + Intronic
1152129863 17:78469640-78469662 CCAGGTTCACAGCAGCCATCAGG + Intronic
1152447441 17:80354035-80354057 ACAGCTTCTCAGCAGCCTGGTGG - Exonic
1152919500 17:83058914-83058936 CGGGGCTCACAGCAGGCTGCCGG + Intergenic
1153391397 18:4564416-4564438 TCTGGATCACAGCAGGCTACTGG + Intergenic
1153822610 18:8845085-8845107 GCAAGTGCACAGCAGCCTGCTGG - Intergenic
1153999261 18:10469888-10469910 ACAGCCTCACATGAGGCTGCTGG + Intronic
1155294899 18:24376141-24376163 AGAGAATAACAGCAGGCTGCCGG - Intronic
1155699657 18:28727841-28727863 ACAGCCTCAGAGCTGGCTGCTGG + Intergenic
1158155873 18:54424744-54424766 GCAGGTTCAAAGCAGCCTGAGGG + Intergenic
1160352249 18:78193607-78193629 TCAGCTTCACAGCAGGAAGCAGG - Intergenic
1160800935 19:968418-968440 TCAGGTTCACAGCAGAGTCCTGG - Exonic
1161423849 19:4191226-4191248 CCAGTTTCGCAGCAGGCAGCCGG + Intronic
1161579610 19:5073583-5073605 AGAGGTTGACAGGAGCCTGCTGG + Intronic
1161990017 19:7679197-7679219 GCAGGTTCACACTAGGCTGGGGG - Exonic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1165093061 19:33396641-33396663 ACAGGGGCACAGGAGGCTCCTGG + Intronic
925032424 2:661157-661179 GCAGGTGCACAGCAGGTAGCAGG - Intergenic
925154499 2:1639211-1639233 ACAGGCCCACAGCAGGATGCCGG + Intronic
926128738 2:10287064-10287086 AGAGGGTCACAGGAGGCTCCAGG - Intergenic
926844710 2:17123552-17123574 AGAGTTTCATAGCAGGATGCTGG + Intergenic
927382233 2:22492339-22492361 ACAGGTGCACAGCACCATGCTGG + Intergenic
927474159 2:23399859-23399881 ACAGGTCAACAGCAGACGGCAGG - Intronic
928949778 2:36804393-36804415 TCAGGCTCACCCCAGGCTGCAGG + Intronic
928986774 2:37189806-37189828 ACAGGGCCACACCAAGCTGCTGG - Intronic
929598161 2:43188942-43188964 ACAGGTTCAGAATAGGCTGCTGG - Intergenic
929823387 2:45291154-45291176 GGATGTTCACAGGAGGCTGCTGG - Intergenic
931880907 2:66569740-66569762 AGGTGTGCACAGCAGGCTGCGGG + Intronic
932887639 2:75561295-75561317 ACAGGCTCAAAGCAGGCGACGGG - Intronic
934313534 2:91893966-91893988 CCAGGTTCTCAGGAGGCTGAGGG + Intergenic
935332078 2:101984808-101984830 ACTTGTTCACTGCAGGTTGCTGG + Intergenic
935640506 2:105285543-105285565 CCAGGTACACAGCAGGCAGCTGG + Intronic
937223100 2:120353329-120353351 ACAGCAGCACAGGAGGCTGCAGG - Intergenic
938919811 2:135985281-135985303 GCACGTTCTCCGCAGGCTGCGGG - Intronic
939091109 2:137781030-137781052 TCAGGTTCATATCAGGCAGCTGG + Intergenic
942067549 2:172285730-172285752 ACAGGGGCACAAAAGGCTGCTGG + Intergenic
947479012 2:230480530-230480552 ACATGTTCTCAGTAGGCAGCTGG + Intronic
948616736 2:239204151-239204173 ACAGGTTCACAGAAGCCGCCAGG - Intronic
1169189350 20:3648034-3648056 ACAAGTTCAGAGGAGGCTGCAGG - Exonic
1170945553 20:20888059-20888081 ACAATGTCACAGCTGGCTGCTGG + Intergenic
1171520285 20:25770497-25770519 ACAGGTGAGCATCAGGCTGCAGG + Intronic
1171556634 20:26085996-26086018 ACAGGTGAGCATCAGGCTGCAGG - Intergenic
1172505441 20:35458300-35458322 CCAGGTTCACAGGTGGCTGTTGG + Exonic
1172951826 20:38727290-38727312 AGAGGTTAAGAGCAGGCTGCGGG - Intronic
1174321578 20:49746069-49746091 ACAGGTACACAGCACTGTGCTGG + Intergenic
1174445044 20:50585334-50585356 ACTGTTTCAAAGCTGGCTGCAGG + Intergenic
1175259341 20:57664745-57664767 ACAGCTTCACAGCCGGCTCCAGG - Intronic
1175293877 20:57895669-57895691 CCAAGTTCACAGCTGGCAGCTGG - Intergenic
1175401044 20:58700034-58700056 GCAGGCTCACAACAGGCTGCTGG + Intronic
1175770637 20:61621996-61622018 ACAGATTAACAACCGGCTGCTGG - Intronic
1175974783 20:62705278-62705300 ACTGGTTTGCAGCAGGCTTCAGG - Intergenic
1176157337 20:63628121-63628143 ACAGGATCCAAGCTGGCTGCCGG - Intergenic
1176158415 20:63635565-63635587 ACGAGTGCACAGCAGGCTGTGGG + Intergenic
1176616539 21:9031324-9031346 CCAGGTGGACATCAGGCTGCAGG + Intergenic
1176654421 21:9576784-9576806 ACAGGTGAGCATCAGGCTGCAGG + Intergenic
1178240780 21:30897757-30897779 AGAGGAACAAAGCAGGCTGCTGG + Intergenic
1180062668 21:45393719-45393741 GCAGGGACACAGCAGGCTGTGGG + Intergenic
1180127479 21:45802241-45802263 AGAGGCTCACAGCTGGGTGCTGG + Intronic
1180940994 22:19659404-19659426 CCAGGTGGACACCAGGCTGCAGG + Intergenic
1181685915 22:24528002-24528024 CCAGGTACTCAGCAGGCTGAGGG + Intronic
950675526 3:14551993-14552015 AGAGGTTCACTCCAGGCTGCCGG + Intergenic
953390132 3:42529048-42529070 ACATGTGCACAGGAGGCAGCAGG - Intronic
954415883 3:50393094-50393116 AGAGATTCACAGCTGGCTGTCGG - Intronic
955377792 3:58412510-58412532 AGAGGTGCAGAGCAGCCTGCTGG - Intronic
961416721 3:126764580-126764602 CCAGGTTTACATGAGGCTGCCGG + Intronic
962909943 3:139838796-139838818 TCAGTTACACAGCATGCTGCTGG - Intergenic
962912040 3:139861930-139861952 ACATGTTCAGATCAGGCTGATGG + Intergenic
967123607 3:186405533-186405555 ACAGGTTCACAGAATTCTTCGGG - Intergenic
968442446 4:630743-630765 AGAGGTCCAGAGCAGGCAGCCGG - Intronic
968643438 4:1726676-1726698 ACAGGCCCACAGCAGGCTGGAGG + Intronic
968698674 4:2044596-2044618 CCAGGTGAACAGCAGGCTGGAGG + Intergenic
969339418 4:6530879-6530901 ACAGGTGCACAGCAGCCTGGTGG - Intronic
970425312 4:15940362-15940384 ACAGCATCAGAGCAGGCTGTGGG + Intergenic
970546283 4:17133594-17133616 ACAGGAGCACAGCTGGGTGCAGG - Intergenic
970551713 4:17188378-17188400 CAAGGGTCAGAGCAGGCTGCAGG + Intergenic
971198036 4:24487900-24487922 ACTGGTTAATAGCAGGCTGAAGG - Intergenic
971487344 4:27173569-27173591 CCATTTTCACAGCAGCCTGCTGG + Intergenic
972631248 4:40843871-40843893 AGAGTTTGACAGTAGGCTGCAGG + Intronic
978630273 4:110735888-110735910 CCAGGTTGACATCAGGCTGGTGG + Intergenic
979283030 4:118888856-118888878 ACAAATTCGCAGCAGGCGGCTGG + Exonic
982828696 4:160031825-160031847 ACATGTGCACAACATGCTGCAGG + Intergenic
986897832 5:12392392-12392414 TGAGGATCACAGCAGGATGCTGG - Intergenic
988485783 5:31667263-31667285 CCAGGCACACAGCAGGCAGCAGG - Intronic
992557278 5:77916086-77916108 ATGGGATCACGGCAGGCTGCAGG - Intergenic
996763184 5:127006842-127006864 AGAGGTACACAAAAGGCTGCGGG - Intronic
1001769109 5:174279450-174279472 ACAGGTTCATAGCCAGCAGCAGG - Intergenic
1001888458 5:175317786-175317808 AGAGATTCACAGAAGGCAGCAGG + Intergenic
1002445341 5:179287094-179287116 ACAGAATCGGAGCAGGCTGCTGG + Intronic
1002838434 6:885134-885156 ACAGGTTCAAAGCCGGCCGAGGG + Intergenic
1003513538 6:6801055-6801077 CCAGTTTCACAGCCGGCTGGTGG + Intergenic
1003513544 6:6801099-6801121 ACAGTTTCACAGCCAGCTGGTGG + Intergenic
1005834077 6:29694752-29694774 ACAGGCTCACAGCCTCCTGCAGG + Intergenic
1006030744 6:31175098-31175120 AAGGGATCACAGCAGACTGCTGG + Intronic
1006490827 6:34386134-34386156 GCTGTTACACAGCAGGCTGCTGG - Intronic
1009907431 6:69887529-69887551 GCAGGTACACAGAAGGCTTCTGG - Intronic
1011670047 6:89674546-89674568 AGAGATTCACAGCAGGCTGATGG - Exonic
1011838599 6:91467120-91467142 AGAGGTTCACTGAAGGCTCCAGG + Intergenic
1015117707 6:129667733-129667755 ACTGGTTCCCAGCAGGCTCTTGG + Intronic
1017899351 6:158705847-158705869 GCTGGTGCACAGCAGTCTGCGGG - Intronic
1018491898 6:164302636-164302658 TCAGGTTCAGAGTAGGCTACAGG - Intergenic
1018903017 6:168060535-168060557 ACTCGGGCACAGCAGGCTGCAGG + Intronic
1020347527 7:7182172-7182194 ACGGGTTAAGAGCAGGCTACAGG + Intronic
1020353714 7:7253741-7253763 ACGGGTCCACATGAGGCTGCTGG - Intergenic
1024219765 7:47278348-47278370 ACAGGTGGCCAGCAGGGTGCTGG - Intronic
1025280780 7:57625452-57625474 ACAGGTGAGCATCAGGCTGCAGG + Intergenic
1025303950 7:57840055-57840077 ACAGGTGAGCATCAGGCTGCAGG - Intergenic
1029218715 7:98970813-98970835 ATGGGTTCTGAGCAGGCTGCTGG - Intronic
1029736443 7:102468256-102468278 CCAGCTTCACAGCAGGCTGTGGG - Exonic
1032612172 7:133426302-133426324 ACAGATTCAGAGCCAGCTGCAGG - Intronic
1033194032 7:139311422-139311444 ACAGGTTGACAGCAGACAGACGG + Intergenic
1034265615 7:149779295-149779317 GCTAGTTCACAGCAGGCAGCCGG - Intergenic
1035192073 7:157178907-157178929 ACAGGCTCACAGCAGCAGGCTGG - Intronic
1035619361 8:1025890-1025912 ACAGGGACAGAGCACGCTGCAGG + Intergenic
1036037916 8:5040574-5040596 TCAGATTCACAGCTGGCTGGAGG - Intergenic
1036406895 8:8463122-8463144 AGAGGTGGACAGCAGGTTGCAGG - Intergenic
1039079537 8:33721738-33721760 GCAGGGCCCCAGCAGGCTGCCGG + Intergenic
1041916748 8:63146231-63146253 AGAGATGCACAGCAGTCTGCTGG + Intergenic
1042627455 8:70773950-70773972 ACAGTTTCACAGCAATCTGTTGG + Intronic
1042957787 8:74270812-74270834 CCAGGCAGACAGCAGGCTGCTGG - Intronic
1047311855 8:123698683-123698705 GCATGTTCTCAGCAGGTTGCAGG - Intronic
1047403172 8:124562874-124562896 ACAGCCTCACAGGAGCCTGCTGG + Exonic
1049309725 8:141927452-141927474 CCAGGTACACAGCAGTTTGCAGG - Intergenic
1049520150 8:143083632-143083654 ACAGGTGCCCGACAGGCTGCAGG - Intergenic
1049867147 8:144946556-144946578 ACAGGCCCACAGCAGGGTACAGG - Intronic
1049867197 8:144946756-144946778 ACAGGCCCACAGCAGGGTACAGG - Intronic
1049867241 8:144946939-144946961 ACAGGCCCACAGCAGGGTACAGG - Intronic
1049867295 8:144947156-144947178 ACAGGCCCACAGCAGGGTACAGG - Intronic
1049867336 8:144947323-144947345 ACAGGCCCACAGCAGGATACAGG - Intronic
1049867345 8:144947360-144947382 ACAGGCCCACAGCAGGATACAGG - Intronic
1049867349 8:144947378-144947400 ACAGGCCCACAGCAGGATACAGG - Intronic
1053260871 9:36662531-36662553 ACAGATTCACAGCAGGGTGCAGG - Intronic
1055391578 9:75827546-75827568 ACAGATTCCCAACAGGATGCAGG + Intergenic
1055728264 9:79255158-79255180 ACATGTTCACAGGTGGCTGATGG - Intergenic
1058717067 9:107732038-107732060 GCAGGTGCACACCAGGCTGAGGG + Intergenic
1060036389 9:120259640-120259662 TCAGGTTCCCAGCAGGGTGCTGG + Intergenic
1060782629 9:126424027-126424049 ACAGGTTCACTGCAGACTTCAGG + Intronic
1203632142 Un_KI270750v1:80242-80264 ACAGGTGAGCATCAGGCTGCAGG + Intergenic
1186761380 X:12726394-12726416 ACAGTTTCACGGAAGGCAGCTGG - Intergenic
1190043949 X:47097183-47097205 AAAGGTTAACAGCATGGTGCTGG + Intergenic
1190748292 X:53339909-53339931 ACAGGTTAACTGCAGGTTGTAGG - Intergenic
1193320074 X:80111401-80111423 ACAGTTTCTCAGCAGGCTCCAGG - Intergenic
1195254664 X:103080371-103080393 ACAGGTTCACAACAGGCTTCAGG - Intronic
1198092043 X:133341152-133341174 ACAAGTTCACAGCAGGCCTTCGG + Intronic
1199943843 X:152650069-152650091 CCAGGTTCACAACACTCTGCAGG + Intronic