ID: 1132462046

View in Genome Browser
Species Human (GRCh38)
Location 16:60363-60385
Sequence GCTGTGGTGCAGAGGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132462046_1132462063 24 Left 1132462046 16:60363-60385 CCCTACACCCTCTGCACCACAGC 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1132462063 16:60410-60432 CAGGTGAGAGAGCTGCCGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 287
1132462046_1132462061 5 Left 1132462046 16:60363-60385 CCCTACACCCTCTGCACCACAGC 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1132462061 16:60391-60413 GGGAAGGTGTGGACAAAGGCAGG 0: 1
1: 1
2: 0
3: 38
4: 449
1132462046_1132462055 -6 Left 1132462046 16:60363-60385 CCCTACACCCTCTGCACCACAGC 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1132462055 16:60380-60402 CACAGCCCCCGGGGAAGGTGTGG 0: 1
1: 1
2: 2
3: 37
4: 454
1132462046_1132462059 1 Left 1132462046 16:60363-60385 CCCTACACCCTCTGCACCACAGC 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1132462059 16:60387-60409 CCCGGGGAAGGTGTGGACAAAGG 0: 1
1: 0
2: 1
3: 11
4: 190
1132462046_1132462062 20 Left 1132462046 16:60363-60385 CCCTACACCCTCTGCACCACAGC 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1132462062 16:60406-60428 AAGGCAGGTGAGAGAGCTGCCGG 0: 1
1: 0
2: 5
3: 48
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132462046 Original CRISPR GCTGTGGTGCAGAGGGTGTA GGG (reversed) Intronic
901987131 1:13084962-13084984 GCTCTGGAGCAGTGGGTGTCTGG - Intergenic
901994681 1:13141805-13141827 GCTCTGGAGCAGTGGGTGTCTGG + Intergenic
903184062 1:21619580-21619602 GCTGTGGGGTGGAGGGTGGAGGG + Intronic
903530479 1:24026476-24026498 GCTGTGGTGGGGATGGTGGACGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
905782369 1:40723458-40723480 TCTGTGGGGCAGAGGGGGTCTGG + Intronic
905797824 1:40825469-40825491 GTTTTGGTGCAGAGGATGCAGGG + Intronic
906608474 1:47186920-47186942 GCTGTGGTACAGAGAGGGCATGG - Intronic
910711797 1:90189771-90189793 GCTGTGGTGCACAGGATGACAGG + Intergenic
919905680 1:202076786-202076808 GCTGTGGTGGGGAGGGACTATGG + Intergenic
922507272 1:226133804-226133826 GCTGTGCTGCAGAGACTGGATGG + Intergenic
923460549 1:234206139-234206161 GGAGTGGTGCAGTGGGTTTATGG - Intronic
924449561 1:244165307-244165329 ACTGTAGTGCAGAGGGCGAAAGG + Intergenic
1063461093 10:6215442-6215464 GCTGCGGGGCTGCGGGTGTAAGG + Intronic
1064811657 10:19206866-19206888 GCTGTAGGGCAGAAGGTGAATGG - Intronic
1065865453 10:29911154-29911176 GGTGAGGTGCAGAGCGTGGAAGG - Intergenic
1066335047 10:34467848-34467870 CCTGTGCTGCAGAGGTTTTAAGG + Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067529171 10:47058029-47058051 TGTGTGGGGCAGAGGGTATAAGG + Intergenic
1067552508 10:47245599-47245621 GCTGTGGTGGGGTGGGTGTGGGG - Intergenic
1067709450 10:48636554-48636576 GCTGTGGTGCAGGTGGTACAAGG - Intronic
1068845155 10:61663212-61663234 GCCGGGCTGCAGAGGGTGTCGGG - Intronic
1068955388 10:62815788-62815810 GATGGGGTGCAGTGGGTGTGCGG - Intronic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070951855 10:80437443-80437465 GCTGTGGGGAAGAGGCTGTAGGG + Intergenic
1070961653 10:80503990-80504012 GTTGTGGTGCACATGGGGTATGG + Intronic
1072569187 10:96643627-96643649 GATGTGGTCCAGAGGTTGTTAGG - Intronic
1073603518 10:104870501-104870523 GCTGAGGTGCAAGGGGTGGATGG - Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074846947 10:117406825-117406847 GCTCTGGGGCAGAGGGCGGAGGG + Intergenic
1075049089 10:119169024-119169046 GCTGTGGGGTAGAGGGGGTGGGG - Intronic
1075320174 10:121485154-121485176 GCTTTGGATCAGAGGGTGTCTGG - Intronic
1075588069 10:123671605-123671627 TCTATGGTGCAGAGCGTGTGAGG - Intronic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1077111582 11:864377-864399 GCTGTGGGGCGGAGGCTGTGCGG + Intronic
1083163070 11:60867520-60867542 GCTCTGGTGGCGAGGGAGTAGGG + Intergenic
1086164751 11:83764498-83764520 GCTGTGGTGGTGAGGTTGGATGG + Intronic
1088929762 11:114339844-114339866 TATGGGGAGCAGAGGGTGTATGG + Intergenic
1089629264 11:119773910-119773932 GGTGGGGTGCAGAGTGTGTATGG + Intergenic
1090388014 11:126367670-126367692 TCTGAGGTGCATAGAGTGTAGGG + Intronic
1090766163 11:129878105-129878127 GCTGTGGTGGAGAGAGGGGACGG - Intronic
1091389345 12:116518-116540 GCTGGGGTGTAGAGGGCTTAAGG + Intronic
1092458020 12:8662003-8662025 GCTGAGGAGCTGAGGGTTTAGGG + Intronic
1093747881 12:22763758-22763780 GCTGTGGAGGGGAGGGTGTCAGG - Intergenic
1098182431 12:67862206-67862228 GTGGTGGTGCTGAGGATGTAGGG + Intergenic
1101546912 12:105722487-105722509 GCTGTTGTGCAGAGGATGCTGGG - Intergenic
1103190449 12:118997126-118997148 GCTGTGGTCAAGAGCATGTATGG - Intronic
1106423230 13:29601292-29601314 GCTGTGATGAAGGGGGTATATGG + Intergenic
1107769482 13:43774923-43774945 CCTGTGGAGCAGAGGTTGCAGGG - Intronic
1108572989 13:51768782-51768804 TCTGCAGTGCAAAGGGTGTAAGG - Intronic
1109092123 13:58061397-58061419 GCTGGGATGCAGTGGTTGTATGG - Intergenic
1111757644 13:92418926-92418948 GCTGTGGTGAAGAGGTGGTAAGG - Intronic
1114390265 14:22300465-22300487 GCAGTGGTGCAGAGGGTCAGAGG - Intergenic
1115141534 14:30177099-30177121 GCCTTGGGGCAGAGGTTGTATGG - Intronic
1115148585 14:30256470-30256492 GCTTTGGGGCAGAGACTGTAGGG + Intergenic
1116293148 14:43068194-43068216 ACTGTGGTGGAGTGGGGGTAGGG + Intergenic
1117066790 14:52019259-52019281 GCTGTTGTTCACAGGGTGTCAGG + Exonic
1117516028 14:56502140-56502162 GCTGGGGTGTGGAGGGTGGAGGG - Intronic
1117643262 14:57823122-57823144 GCTGTGGTGAGGAGTGTGGAGGG - Intronic
1119556360 14:75556330-75556352 GCTGGGGGACAGAGGGTGCAAGG - Intergenic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1120093900 14:80366064-80366086 GCTGTGGTGGGGAGGTTGGAAGG - Intronic
1120782315 14:88495950-88495972 GATATGGTGCAGAGGCTGGAGGG + Intronic
1121083598 14:91128066-91128088 GCTGTGTTGAGGTGGGTGTAAGG - Intronic
1121090843 14:91181303-91181325 GCTGTAGTGCAGAGGATCTTGGG - Exonic
1121311258 14:92936374-92936396 GCAGTGGTGGAGAGGGTGCAGGG + Intergenic
1121636483 14:95457232-95457254 GCGGTGGTGGAGAAGGTGAATGG - Exonic
1121739081 14:96238837-96238859 ACTGTGGCCCAGAGGGTGGAGGG - Intronic
1122259584 14:100506070-100506092 ACTGTGGTCTAGAGGGTGGAGGG - Intronic
1122421677 14:101581855-101581877 GCTGTGTGGCACAGGGTGTAAGG - Intergenic
1124255276 15:28136436-28136458 TCTCTGGTGCACAGGGTGCAGGG + Intronic
1125832652 15:42727769-42727791 GCTGTGGGGCAGAGGGAGAATGG + Exonic
1127880378 15:63152083-63152105 GCTGTGTTGCCCAGGCTGTAAGG - Exonic
1129298401 15:74612168-74612190 GCTCTGGTGCAGACAGTGTTGGG - Intronic
1129523270 15:76198917-76198939 GGTCTGGAGCAGAGGGAGTAGGG + Intronic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1132462046 16:60363-60385 GCTGTGGTGCAGAGGGTGTAGGG - Intronic
1133607948 16:7406453-7406475 CCTGTGGCCCAGAGGGTGGATGG + Intronic
1134069833 16:11254302-11254324 GCTGGGCTGCAGGTGGTGTACGG - Intronic
1134235422 16:12461532-12461554 GCTCTGGTGCTGAGGCTGCAGGG + Intronic
1134610857 16:15606843-15606865 GCTGTGGGGCTGAGGGAGCAAGG - Intronic
1134782565 16:16911632-16911654 GCTGTGGTTCAGAAGCTTTAAGG + Intergenic
1134849258 16:17467768-17467790 GGTGTGTTGCAGAGAGTGTCAGG - Intronic
1135415965 16:22268053-22268075 GCTGTGGCCCAGTGGGTGAATGG + Intronic
1135541120 16:23331126-23331148 GCTGTGTTGAAGAGGGTGGCAGG + Intronic
1135983702 16:27168325-27168347 GCGGTGGTGATGAGGGTGTCAGG + Intergenic
1136316915 16:29459909-29459931 GGTGTGGTGTAGGGAGTGTAGGG - Exonic
1136431490 16:30199251-30199273 GGTGTGGTGTAGGGAGTGTAGGG - Intronic
1138125805 16:54437592-54437614 GCTGCGCTGCAGAGGCTGTGGGG + Intergenic
1138190305 16:55009068-55009090 TCTCTGGAGAAGAGGGTGTAGGG - Intergenic
1138850720 16:60626651-60626673 GGAGTGGGGCAGAGGGTGCAGGG + Intergenic
1140475542 16:75237858-75237880 GCTGTGGGGCAGGGGGTGCTAGG - Intronic
1141289844 16:82707592-82707614 TCAGGGGTGCAGAGGGTGTGTGG + Intronic
1141524987 16:84605235-84605257 GCTGGGGTGCAGGGGGTGTCAGG + Intronic
1141775035 16:86117463-86117485 TCTGTGGTGCAGGGGGTCTGGGG - Intergenic
1141954436 16:87360976-87360998 GCTGTGGTGGGGTGGGAGTAGGG - Intronic
1142290202 16:89190576-89190598 TCTGAGGGTCAGAGGGTGTAGGG + Intronic
1142314290 16:89333721-89333743 GATGTCCTGCAGAGGGTGAATGG - Intronic
1143179415 17:4974807-4974829 GCTGGGGGGAAGAGTGTGTACGG - Intronic
1143349083 17:6273796-6273818 GCTTTGGTGCCCAGGGTGGAAGG - Intergenic
1143585547 17:7848640-7848662 GCTGTGGCTGAGAGGGTGGAGGG - Exonic
1144440992 17:15281509-15281531 GCTTTGGTGCAGAGGGTGGGGGG - Intergenic
1146612380 17:34319239-34319261 TCTGTGGAGCAGAGGCTGAAGGG - Exonic
1147354044 17:39877332-39877354 TATGGGGTGCAGTGGGTGTATGG - Intronic
1152371886 17:79893392-79893414 GCTGTGGAGCACAGGGAGGAAGG - Intergenic
1152386983 17:79980567-79980589 ACTGTGGTGCAGACAGTGTAGGG + Intronic
1152607799 17:81301813-81301835 GTTGTGGGGCAGAGGGTGCTTGG - Intergenic
1152838915 17:82553790-82553812 GCTGTGACGCAGATGGTGGATGG + Intronic
1155029795 18:21974147-21974169 CCTGTGGTGAAGATGGTGTGAGG + Intergenic
1156123184 18:33870332-33870354 GCTGGGGTGAATAGGGAGTAGGG + Intronic
1157556685 18:48617562-48617584 GCTGTGGAGCAGGAGGAGTAAGG + Intronic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1161772272 19:6237249-6237271 GGTGTGGGGCAGAGGGAGTGTGG - Intronic
1163426231 19:17242556-17242578 GCAGTGGTGGAGGGGGGGTACGG - Intronic
1163633579 19:18428690-18428712 GCTCTGGCGCACAGGGGGTAGGG - Intronic
1163830653 19:19545697-19545719 GTTGTGGCCCAGAGGGTCTAGGG - Exonic
1164323929 19:24176130-24176152 ACTGTGGTGGAGAGGGGGGAAGG - Intergenic
1165921042 19:39298064-39298086 GATGTGGTGCAGGGTGTGAAGGG - Exonic
1166290982 19:41863385-41863407 GCTGTGGTGCAGACGGGCGAAGG + Intronic
1166938979 19:46351630-46351652 GCTGTGGTCCAGAGGCTGCCTGG - Intronic
1167054696 19:47102484-47102506 ACTGGGGTGCAGAGTGTTTAAGG - Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167102784 19:47414558-47414580 GCTGTTGTGTAGTGGGTGTGTGG + Intronic
1168240360 19:55086149-55086171 GCTGTGGTGCAGCCGGGGTCCGG - Exonic
925063374 2:910517-910539 CCTGGGGTGCAGAGGCTGTTGGG - Intergenic
925095110 2:1192181-1192203 GATGTGGGGCAGAGGGAGTTGGG + Intronic
927036161 2:19178816-19178838 GATGAGGTGGAGAGGGTATATGG - Intergenic
927320409 2:21737690-21737712 GCAGTGTTGATGAGGGTGTAGGG + Intergenic
930221035 2:48747121-48747143 GCTCTGTTGCAGAGGCTGGAGGG + Intronic
932370899 2:71186963-71186985 GCTGTGGGACAGAGGTTGGAAGG - Exonic
932585519 2:73025675-73025697 GCAATGCTGCAGAGGGTGGAAGG + Intronic
932615606 2:73229455-73229477 GCTCTGGTGGAGAGGGGGTAAGG - Exonic
932770706 2:74499438-74499460 GCTGCGGCGCAGAGGGTGCTCGG + Exonic
935345732 2:102106106-102106128 GCTGTGTTGGTGAGGGTGTGAGG + Intronic
936698462 2:114981020-114981042 GCTGTTCTGCAGTGAGTGTATGG + Intronic
937262359 2:120594723-120594745 TCTCTGTTGCAGAGGGTGGAGGG + Intergenic
938875275 2:135526024-135526046 GCTGTGGTGCAAAGGATACAGGG + Intronic
939619929 2:144406594-144406616 GCTGGAGTGCAGAGGATGAAAGG + Intronic
941588198 2:167385618-167385640 GCTGAGGGGCAGAGGGTTTATGG + Intergenic
942168144 2:173262703-173262725 GCTGGGGTGCACAGGTTGTCAGG + Intronic
945147616 2:206755056-206755078 GCTGTGGCGCTGGGGGTGGAAGG - Exonic
946296025 2:218783999-218784021 GGAGAGGTGCAGAGGGTCTAAGG + Intronic
946621080 2:221563795-221563817 ACTGTGGGGCAGATGGTGAATGG - Exonic
948378109 2:237535538-237535560 GCCGGGGTGCAGAGGGAGTAGGG + Intronic
948846573 2:240685691-240685713 GCTGAGGTGCCCAGGGTGTCAGG - Intergenic
948847288 2:240689043-240689065 GCTGAGGTGCCCAGGGTGTCAGG + Intergenic
948888629 2:240896422-240896444 GCTGTGGGGAGGAGGGTGGAAGG - Intronic
1168889044 20:1281948-1281970 GCCATGGGGCAGAGGGTGGAGGG + Intronic
1171399687 20:24864847-24864869 CCTATGTTTCAGAGGGTGTATGG + Intergenic
1172061469 20:32190006-32190028 CCTGTGGTGCAGAGGGGCTAGGG - Intergenic
1172969734 20:38864741-38864763 ACTTGGGTGCACAGGGTGTAGGG + Intronic
1177659530 21:24064880-24064902 GGTGTGGTGCAGTGCATGTAGGG + Intergenic
1179124359 21:38578025-38578047 GCTGTGCTGCTGAGGGTATGGGG - Intronic
1179210131 21:39317466-39317488 GCTGAGGCGCAGAGGAAGTATGG + Intronic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179410480 21:41159305-41159327 GGTGTGGTGCAGAGGTAGGATGG + Intergenic
1179600974 21:42476981-42477003 GCTGTGGGACAGAGGGTGTGGGG - Intronic
1179600987 21:42477014-42477036 GCTGTGGGACAGAGGGTGTGGGG - Intronic
1179601069 21:42477210-42477232 GCTGTGGGACAGAGGGTGTGGGG - Intronic
1179613501 21:42567020-42567042 GCGGTGGTGATGAGTGTGTAGGG - Exonic
1180047032 21:45311682-45311704 GTGGTGGAGCAGAGGGTGCATGG - Intergenic
1180047221 21:45313342-45313364 GTGGTGGGGCAGAGGGTGCATGG + Intergenic
1181461409 22:23088319-23088341 GATGTGGGGCAGAGTGGGTAAGG - Intronic
1181736290 22:24884223-24884245 GCAGTGATGCAGAGGCTGCAGGG + Intronic
1181760098 22:25052276-25052298 GCTGTCTTGCAGAGGGTGCCTGG + Intronic
1182785752 22:32906221-32906243 GCTGTGTTGCAGAGGGTCCCAGG - Intronic
1183704255 22:39467275-39467297 GAGCTGGTGCAGAGGGTGAAGGG + Intronic
1183747125 22:39698375-39698397 CCTGTGGTGCATGGGGTGGAGGG + Intergenic
1185011823 22:48318844-48318866 GCTCTGGTGCAGTGGGAGGAGGG - Intergenic
949973087 3:9428119-9428141 GCGTGGGTGCAGAGGGTGCATGG - Intronic
950361423 3:12452153-12452175 GCTGTGGTGCAGGGCTTGCATGG - Intergenic
950429988 3:12945078-12945100 GGTGTGGGGCAGAGGGGGTTGGG + Intronic
950572635 3:13811523-13811545 GCTCTGGCTCAGAGGGTGGAAGG + Intergenic
950614648 3:14148938-14148960 CCTCTGGTGCAGATGGTGAAAGG - Exonic
951434464 3:22645531-22645553 GTTTAGGTGCAGAGGCTGTATGG + Intergenic
952075051 3:29685853-29685875 GCAGTGGTGCAGAAGGTGTGGGG - Intronic
953100459 3:39820763-39820785 TCTGTGGTCCAGAGGATGTCAGG + Intronic
953206201 3:40831977-40831999 GATGGGGTGCAAAGGGTGTGTGG - Intergenic
953290921 3:41661644-41661666 CCTGTGAGGCAGAGGGTGTGGGG + Intronic
953743178 3:45554332-45554354 GGTGTGGTGTAGGTGGTGTATGG - Intergenic
954121170 3:48500995-48501017 GCATTGGAGCAGAGGGTTTAGGG - Intronic
954243319 3:49311108-49311130 GATGTGGGGAAGAGGGTGAATGG - Intronic
956252626 3:67250568-67250590 GCAGTGGTGTAGAGGCTGAAAGG - Intergenic
958960408 3:100504438-100504460 TCTGTGGTGCATAGGTTATACGG - Intronic
960703894 3:120463578-120463600 GCTGTGGTGCAGGGGTTATAAGG - Intergenic
961093735 3:124137479-124137501 GCATTTGTGCAGAGGATGTAAGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
963242855 3:143026955-143026977 GGTGTGGGGCAGTGGGAGTAGGG - Intronic
963283694 3:143412403-143412425 GCTGTGCTGTAGAAGGTGCAGGG - Intronic
963312259 3:143721753-143721775 GCAGTGGTGGAGAGGGAGGAAGG + Intronic
963788121 3:149556067-149556089 GCTGAGGAGCAGAGGGTGAGGGG + Intronic
964607445 3:158572689-158572711 GGTGTGGGGAAGAGGGTTTAGGG + Intronic
966771541 3:183508305-183508327 GATGTGGTGCAGAGTGTCCACGG + Exonic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968079450 3:195836035-195836057 GCGGTGGTGGGGACGGTGTAGGG - Intergenic
968461244 4:726076-726098 GCTGTGGGGCAGAGGCTGGCGGG + Intronic
970224379 4:13842308-13842330 TCTGTGGTGATGAGGGTGGAAGG + Intergenic
971177441 4:24293511-24293533 GCAGTGGGGCTGAGGGGGTAGGG - Intergenic
971607682 4:28679527-28679549 GATGTGGTGGTGCGGGTGTATGG - Intergenic
972576700 4:40358391-40358413 GCTGTGTCGCAGAGGCTGGAGGG - Intergenic
973289178 4:48453434-48453456 TGTGTGGGGCAGAGGATGTATGG + Intergenic
977229449 4:94434351-94434373 GCAGTGGTGAGGAGGGTGTGGGG - Intergenic
977744720 4:100532731-100532753 ACTGTGGTGGAGAGGGAGTCTGG - Intronic
980061135 4:128131233-128131255 GTTTGGGTGCAGAGGGTCTATGG + Intronic
980180435 4:129394071-129394093 GCTGAGGTGCAGAGGATTTCAGG - Intergenic
981363997 4:143880100-143880122 GCGGTGGTGCGGAGGGTCTGTGG - Intronic
981374722 4:144000874-144000896 GCGGTGGTGCGGAGGGTCTGTGG - Intronic
981385054 4:144120180-144120202 GCGGTGGTGCGGAGGGTCTGTGG - Intronic
981426305 4:144607564-144607586 GGAGTGGTGGAAAGGGTGTAGGG - Intergenic
982840279 4:160175332-160175354 GCACTGGTGCAGTGGGTGTGTGG - Intergenic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
989431255 5:41358192-41358214 ACTGAGGTTCAGAGGGTTTATGG + Intronic
990289459 5:54333990-54334012 CCAGTGGTGCAAAGGGTGCATGG - Intergenic
990528366 5:56650628-56650650 GCCGTGCTGCAGAGGGTGGGAGG - Intergenic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991617578 5:68513198-68513220 ACTGAGGTCCAGATGGTGTATGG - Intergenic
994445463 5:99867389-99867411 GCTGGGGTGTAGGGGGTATAGGG - Intergenic
997359885 5:133288354-133288376 GCTGTGCTGCTGAGGGTGCCTGG - Intronic
998218341 5:140254525-140254547 GCTGTGGTGGAGAGGGAGACAGG - Intronic
999288853 5:150410264-150410286 ACTGTGGTGCAGAGAGGGGAAGG - Intronic
999670844 5:153958095-153958117 GCTGTGGCGCAGAGGGGATTGGG - Intergenic
1001333797 5:170781655-170781677 GGTGTGGTGCAGAGGTTGCTGGG + Intronic
1002595341 5:180318363-180318385 CCTGTGGGGTAGAGGTTGTAAGG + Intronic
1003127225 6:3364886-3364908 GGTGTGGTGGAGAGGGGGTAGGG + Intronic
1006154559 6:32007252-32007274 GCTCTCCTGCAGAGGGTGAAAGG - Intergenic
1006160870 6:32039988-32040010 GCTCTCCTGCAGAGGGTGAAAGG - Exonic
1006580872 6:35077105-35077127 GCTGTGTTGCTGATGGTGTGGGG + Intronic
1007072865 6:39049298-39049320 ACTGTGGGGCAGAGGGAGTCCGG - Intronic
1010317513 6:74468012-74468034 GCAGTGCTGCAGAGTGAGTATGG + Intergenic
1010592648 6:77728758-77728780 GCTGTGGAGCAGAGCAAGTAAGG + Intronic
1012701931 6:102469214-102469236 TGTGTGGAGCAGAGGGTTTATGG - Intergenic
1016346255 6:143117191-143117213 GCACTGGAGCAGAGCGTGTATGG + Intronic
1018630205 6:165815836-165815858 GCTGTGGTCCAGGGTGTGGAAGG + Intronic
1019163283 6:170083059-170083081 GCAGTGGTGCGGAGGGAGTGGGG - Intergenic
1020592915 7:10166400-10166422 ACTGTGGTGGGGAGGGGGTAGGG - Intergenic
1020869011 7:13604440-13604462 GCTGTGGTACTGAGGGTGGAAGG + Intergenic
1021601858 7:22372447-22372469 GGTGGGGTGCAGAGGTTGTAGGG - Intergenic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1023183985 7:37514490-37514512 GATGGGGTGAGGAGGGTGTAAGG + Intergenic
1023582971 7:41701272-41701294 GTGGTGGGGCAGAGGGTGCAGGG + Intronic
1024165404 7:46724649-46724671 GTTGGGGTGCAGGGGGTCTAAGG - Intronic
1024565493 7:50676748-50676770 ACGGTAGTGCAGAGGGGGTATGG + Intronic
1025734203 7:64132611-64132633 GCTGTGGTGCAGAGATGGTGAGG - Intronic
1029261680 7:99306927-99306949 GCTGGGGAGCAGGGGGAGTATGG - Intergenic
1030127478 7:106168312-106168334 TCTGTGTGGAAGAGGGTGTAGGG + Intergenic
1031020842 7:116625974-116625996 GCTCAGGTTGAGAGGGTGTATGG - Intergenic
1032395601 7:131587367-131587389 GGTGTGGTGCAGCGTGTGTGTGG + Intergenic
1033414112 7:141147304-141147326 GCTGTGGTGCAGAGGAGGTGAGG + Intronic
1034190229 7:149208010-149208032 GCTGGGGTGGAAAGGGTGGAAGG + Intronic
1034592186 7:152150741-152150763 GCAGAGGAGGAGAGGGTGTAGGG - Intronic
1036098640 8:5753159-5753181 GGTGAGGTGCAGAGGCTGTTAGG + Intergenic
1036192489 8:6683121-6683143 GTTGTGGTGAAGATGGTGCATGG - Intergenic
1037503729 8:19509959-19509981 GCTGTGGGACAGAGAGAGTAGGG + Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1038682718 8:29684092-29684114 GCAGGGGTGCAGGGGGTGCAAGG + Intergenic
1041226760 8:55707971-55707993 ACTGTGGTGGAGTGGGGGTAGGG - Intronic
1041411409 8:57560458-57560480 GCTGTGGTGGAGAGGGGGCTGGG + Intergenic
1043304187 8:78773554-78773576 GTTGTGGTGCTGGGCGTGTAAGG + Intronic
1046097792 8:109580840-109580862 GCTGTAGTACAGAGGGAGGAGGG - Intronic
1049454559 8:142680477-142680499 GCTGTGGTGGAGAGGGCCTCAGG - Exonic
1050200288 9:3138103-3138125 GCTCTGTTGCTTAGGGTGTAGGG - Intergenic
1050276658 9:4008008-4008030 GCTTAGGTGCAGAGGGAGTGTGG - Intronic
1050695944 9:8279309-8279331 GCAGCAGTGCTGAGGGTGTAGGG - Intergenic
1052650949 9:31299927-31299949 ACTGTGGTGCGGTGGGGGTAGGG + Intergenic
1053567772 9:39271097-39271119 GCTGTAGTGCAGAGAGTGACAGG - Intronic
1054129371 9:61347902-61347924 GCTGTAGTGCAGAGAGTGACAGG + Intergenic
1054596770 9:67075366-67075388 GCTGTAGTGCAGAGAGTGACAGG + Intergenic
1057843093 9:98501987-98502009 GCTGTGGTGAAGAGAGTGACAGG + Intronic
1060002194 9:119968838-119968860 GCTGTGGTGCGGAGGGCCCATGG - Intergenic
1062313339 9:135951951-135951973 GCTGTGGGGCAACGGGTGTATGG + Intronic
1185575748 X:1170852-1170874 GCGGTGGTGCCAAGGGTGTCTGG + Intergenic
1187153753 X:16705073-16705095 GCAGTGGGGGAGAGGGTGTATGG + Intronic
1195308526 X:103608476-103608498 GCTGGGGTGCGGGGGATGTAGGG + Intronic
1196304647 X:114087109-114087131 GCTGTGGTGGATACGGTGAAAGG + Intergenic
1197314589 X:124949272-124949294 GCTGTGGTGCAGAGGATCAATGG - Intronic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1201314699 Y:12632393-12632415 GCTGTGGGGTAGAGGGCATATGG - Intergenic