ID: 1132462105

View in Genome Browser
Species Human (GRCh38)
Location 16:60577-60599
Sequence CAGGGCAATGAGGGGCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132462092_1132462105 24 Left 1132462092 16:60530-60552 CCAGCGTGGACTGTGGGAGGGGG 0: 1
1: 0
2: 3
3: 26
4: 288
Right 1132462105 16:60577-60599 CAGGGCAATGAGGGGCACGCAGG 0: 1
1: 0
2: 0
3: 18
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132462105 Original CRISPR CAGGGCAATGAGGGGCACGC AGG Intronic
900335594 1:2161456-2161478 CTGGGCAGTGAGGGGCCCTCGGG + Intronic
900622098 1:3592204-3592226 CAGGGCAGTGGGCTGCACGCCGG - Intronic
900861646 1:5237439-5237461 CAGAGCCATGAGGGCCAGGCAGG - Intergenic
901644622 1:10709836-10709858 CAGGACAATGAGGGGGCCGGCGG + Intronic
902621645 1:17654300-17654322 CAGGGAAATGAGGGTCACAGAGG - Intronic
903357793 1:22758712-22758734 CAGTGGTATGAGGGGCAAGCTGG + Intronic
903359464 1:22767692-22767714 CAGGGGGAAGAGGGGCACCCTGG - Intronic
904263394 1:29304034-29304056 CAGGAGTATGAGGTGCACGCCGG + Exonic
905460446 1:38119298-38119320 TAGGGAAATGTGGGGCAGGCAGG - Intergenic
906129549 1:43448007-43448029 CAGGGCAGGGTGGGGCAGGCTGG - Intronic
906748403 1:48237641-48237663 CAGGGCACTGAGGCACACTCGGG - Intronic
907037274 1:51227653-51227675 AAAGGCAATGTTGGGCACGCTGG + Intergenic
907303998 1:53503795-53503817 CAGGGCACGGAGGGGCTCGGGGG - Intergenic
910473337 1:87578802-87578824 TAGGGCAATGAGGGGAGGGCAGG - Intergenic
911309766 1:96278002-96278024 CAGGGCTGTGAGGGTCAAGCTGG + Intergenic
912451526 1:109770460-109770482 CAGGGCAATGAGGAAAAGGCAGG - Intronic
914992638 1:152511893-152511915 CTGGGCCATGAGGAGCACGGAGG + Exonic
915625748 1:157113134-157113156 CAGGGCACAGAGGGGAACTCTGG + Intergenic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
919402107 1:197131649-197131671 CAGGAGAATGAGGGGAACCCGGG - Intronic
919610185 1:199735780-199735802 CAGGGCAGAGTGGGGCAGGCAGG - Intergenic
922872175 1:228911680-228911702 AAGGACAAAGAGGGGCAGGCTGG + Intergenic
1062995202 10:1859065-1859087 CAGGGCACAGAGGGGCGGGCTGG + Intergenic
1071474105 10:86010420-86010442 GAGGGCTATGAAGGGCAGGCAGG + Intronic
1071565076 10:86667541-86667563 CAGGGCCAGGAGGGGCAGGGAGG - Intergenic
1073054310 10:100689250-100689272 CAGGGCTATGAGGGGGGCACAGG + Intergenic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073207024 10:101774987-101775009 TGGGGCAGTGAGGGGGACGCAGG - Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076809312 10:132878481-132878503 CAGGGCCGCGAGGGGCCCGCAGG - Intronic
1077384133 11:2261060-2261082 CGGGGCATTGAGGGGAAAGCTGG - Intergenic
1077425558 11:2474339-2474361 CAGGGCAGTGAGGCTCACGTGGG + Intronic
1077491119 11:2861549-2861571 GGGGGCAATGAGGGGCACAGAGG - Intergenic
1077700258 11:4434828-4434850 CAGGGGAATGAGGGGCATGAAGG - Intergenic
1077891239 11:6419346-6419368 CAGGGCGCTGCGGGGCGCGCAGG - Intronic
1079014015 11:16853748-16853770 CAGGGCTGTGAGGGGCAAGTGGG + Intronic
1079136736 11:17779724-17779746 AAGGGCGCTGAGGGGCAGGCAGG + Intronic
1079886875 11:26001139-26001161 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1079886958 11:26001745-26001767 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1080126401 11:28739569-28739591 CAGAGGAATGAGGGGCATTCGGG - Intergenic
1083309289 11:61776247-61776269 CACGCCACTGAGGGGCACCCAGG - Intronic
1083763224 11:64829958-64829980 CAGGGCAAAGAGACGCACGCTGG + Exonic
1084424681 11:69078048-69078070 GGAGGCAATGAGGGGCAGGCGGG - Intronic
1084910225 11:72381977-72381999 TAGGGCAATGAGGGCCAGCCTGG - Intronic
1085027366 11:73244165-73244187 CCGGGCACTGATGGGCACGGAGG - Intergenic
1085398271 11:76218718-76218740 CATGGCACTGAGGGACAGGCAGG + Intergenic
1089255204 11:117190434-117190456 CAGGGCAGGGTGGGGCAGGCTGG - Intronic
1089454120 11:118615962-118615984 CAGGGCAAGGAGGGCCACAGTGG - Intronic
1089459148 11:118642508-118642530 CAGGGCAATGAGGGCACCTCTGG + Intronic
1090208347 11:124897952-124897974 CAAGGCACTGAGGGCCAGGCAGG - Exonic
1091560595 12:1609880-1609902 CTGGGCAGTGAGGTCCACGCCGG - Intronic
1092955172 12:13542915-13542937 AATGGCAATGAGGGGCAAGAAGG - Exonic
1092996576 12:13956735-13956757 CACGGCAATGAAGCGCACGACGG + Intronic
1093312727 12:17610025-17610047 CAGGACAATAATGGGCAGGCTGG + Intergenic
1094497107 12:30995289-30995311 CTGGGCAGGGAGGGGCACCCTGG + Exonic
1095283806 12:40386470-40386492 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1095945085 12:47749137-47749159 CAGGGGAAGGATGGGCATGCAGG - Intronic
1096217730 12:49807804-49807826 GAGGGGATTGAGGGACACGCTGG - Intronic
1097107812 12:56635548-56635570 GAGGGCACTGAGTGGGACGCAGG - Intronic
1100672147 12:96825043-96825065 CAGGGCATTGTGGGGCGCGTAGG - Intronic
1102602169 12:114039634-114039656 CAGGGCTCTGAGGAGCACTCAGG - Intergenic
1103826468 12:123743147-123743169 CTGGGGAATGCGGGGCACGTGGG - Intronic
1104581402 12:130013811-130013833 CAGGGCCAGGACGGGCACGCGGG + Intergenic
1104815414 12:131642817-131642839 CGGGGATATGAGGGGCACCCTGG - Intergenic
1104857277 12:131908127-131908149 CAGCGCTATGAGGGCGACGCGGG - Intronic
1106230139 13:27815270-27815292 CAGGGAAAGGAGAGGCCCGCGGG - Intergenic
1108876492 13:55056128-55056150 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1109931576 13:69223978-69224000 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1120988569 14:90355183-90355205 CAGGCCAGTGAGCGGCAGGCGGG - Intergenic
1122124383 14:99571156-99571178 CAGTGCAGTGAGGGGCCAGCCGG + Intronic
1122209804 14:100166705-100166727 CAGGGCCATGAGGGGTCAGCAGG + Intergenic
1125577724 15:40766759-40766781 CAGGGCAGTGAGGGGCCTGGAGG + Exonic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1127992886 15:64133762-64133784 CAGGGCAGTGAGGGAGCCGCTGG + Intronic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1129818427 15:78577182-78577204 CAGGGCTCTGAGGGGCACCTTGG - Intronic
1130251795 15:82304631-82304653 CAGGGCAGTGGGAGGCCCGCAGG - Intergenic
1132195686 15:99913149-99913171 CAGAGCACTGAGGTGCAGGCTGG + Intergenic
1132462105 16:60577-60599 CAGGGCAATGAGGGGCACGCAGG + Intronic
1132556571 16:575294-575316 AAGGGCCCTGAGGGGCACGGGGG + Intronic
1134077105 16:11299757-11299779 AGGGCCAATGAGGGGCACTCAGG + Intronic
1134116659 16:11553752-11553774 CAGGACAAAGAGAGGAACGCAGG + Intronic
1137683534 16:50370613-50370635 CAGGGTAATGAGGAGCAGACAGG - Intergenic
1137722011 16:50633053-50633075 CAAGGCAGTGAGGGGCAGTCAGG + Intronic
1137972552 16:53000570-53000592 AAGGGCGATGAGGTGCACCCAGG + Intergenic
1138420824 16:56898029-56898051 CAGGGCAGTGAGGAGCTGGCTGG - Intronic
1138434216 16:56988380-56988402 CAGGCCACTGAGGGGCATGGTGG - Intergenic
1141669037 16:85481943-85481965 CAGGGCCTTGAGGAGCAGGCCGG - Intergenic
1142518514 17:489523-489545 CTGGGCATTGAGGGGCCAGCAGG + Intergenic
1143402484 17:6655567-6655589 CTGTGCAATGAGGGGCGCACAGG - Intergenic
1144025389 17:11272342-11272364 CAGGGAAGTGAGAGCCACGCGGG - Intronic
1144687556 17:17236419-17236441 CAGGGCAAGGAGGAGCTTGCTGG - Intronic
1146749096 17:35361434-35361456 CAGGGTGATGAGGGTCACGGGGG - Intronic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1147914253 17:43877306-43877328 CAGGGGAATGTGTGGCCCGCTGG - Intronic
1148827246 17:50402856-50402878 GAAGGCAATGTTGGGCACGCTGG - Intergenic
1151579944 17:74972194-74972216 GCGGGCAATGAGGGGCAGGGAGG + Intronic
1152919364 17:83058212-83058234 CAGTGCAATGTGGGGAGCGCTGG - Intergenic
1152988492 18:341051-341073 CAGTGCAATGTGGGTCAGGCAGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155799348 18:30081614-30081636 CAGGCCCATGAGTGGCATGCAGG + Intergenic
1156278631 18:35610281-35610303 CAGGGCAATGAGAAGCAGCCTGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1158163043 18:54507635-54507657 CATGGCACTGAGGGGGACGCTGG + Intergenic
1161282868 19:3455059-3455081 CAGGGCAGTGGGGGACAAGCCGG + Intronic
1161574433 19:5047906-5047928 CAGCTCAATGGGGGGCACTCCGG - Intronic
1162449536 19:10746339-10746361 CAGGGCCATGGGGGGCACTTGGG + Intronic
1163388609 19:17015750-17015772 CAGGGCAAGGATGGGCAGGAGGG + Intronic
1163845211 19:19634760-19634782 CAGGACACTGAGGGGGACGCGGG - Intronic
1165153002 19:33771892-33771914 CTGGGCACTGAGGGCCACACAGG - Intronic
1165433235 19:35784091-35784113 CAGGGCAATGAGGGGAGCCAGGG - Intronic
1166759472 19:45215751-45215773 CAGGGGACTCAGGGACACGCAGG - Intronic
1167293989 19:48638939-48638961 CAGGGCACTGAGGGGCAACAGGG - Exonic
1167612469 19:50514070-50514092 CAGGGGAAAGGGGGGCACGCAGG - Intronic
1168270305 19:55246124-55246146 CAGGGCCTTGAGTGGCACGCTGG - Intronic
924974235 2:158287-158309 AAAGGCAATGTTGGGCACGCTGG - Intergenic
925998619 2:9312321-9312343 CAGGTCAATGAGGGGGATTCTGG - Intronic
926864279 2:17341320-17341342 AAAGGCAATGTTGGGCACGCTGG + Intergenic
927713532 2:25340024-25340046 CACGGCAGTGAGGGGCAAGTTGG + Intronic
933460977 2:82585068-82585090 GAGGGCAATGGGCGGCAAGCTGG - Intergenic
933989646 2:87625118-87625140 CAGTTCAGTGAGGGGCACTCAGG + Intergenic
936304198 2:111325708-111325730 CAGTTCAGTGAGGGGCACTCAGG - Intergenic
936387422 2:112042651-112042673 AAAGGCAATGTTGGGCACGCTGG - Intergenic
937225470 2:120366378-120366400 CAGGGCAGCGAGGGGCAGGCAGG + Intergenic
938399271 2:130975540-130975562 CAAGGCAAAGTGGGGCAGGCAGG - Intronic
939493764 2:142904919-142904941 AAAGGCAATGTTGGGCACGCTGG - Intronic
942830677 2:180235132-180235154 AAGGGCAATGTTGGGCATGCTGG + Intergenic
943657614 2:190526266-190526288 CAGGGCACTGAGGGGACAGCAGG - Intronic
948505916 2:238426963-238426985 GAGGGCAATGGGGGGCGCGTCGG - Exonic
948575061 2:238944439-238944461 CATGGCAATGAGTGGCAAGTTGG + Intergenic
948829664 2:240592184-240592206 CCTGGCAGTGGGGGGCACGCTGG - Intronic
948909186 2:240994482-240994504 CCGAGGAATGTGGGGCACGCAGG + Intergenic
948941318 2:241198238-241198260 CGGGGCAGGGAGGGGCACCCTGG - Intronic
1169263845 20:4155870-4155892 CAGTGCCATGAGGGGCTGGCAGG + Intronic
1171455860 20:25271794-25271816 CCGGGCAGTGAGGGTCACTCTGG + Intronic
1173863566 20:46299812-46299834 CAGGGCAAAGATGGGAACCCTGG + Intronic
1174017712 20:47502129-47502151 CAAGGCACTGAGGGGCGCGCCGG + Intronic
1175227660 20:57454161-57454183 CTGAGCAGTGAGGGGCACGGAGG + Intergenic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1175788076 20:61724230-61724252 CAGGGCAGTGAGGAGCCCGCTGG - Intronic
1175799202 20:61791670-61791692 ATGGGCAGTGAGGGGCAGGCTGG + Intronic
1175893373 20:62325091-62325113 CAGGCGGATGAGGGGCAGGCAGG + Intronic
1177896035 21:26856932-26856954 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1179259315 21:39744211-39744233 AAAGGCAATGTTGGGCACGCTGG - Intergenic
1179655449 21:42841867-42841889 CAGAATACTGAGGGGCACGCTGG - Intergenic
1179985694 21:44919327-44919349 CAGAATACTGAGGGGCACGCTGG + Intronic
1181299897 22:21872253-21872275 CCAGGAAATGAGGGGCACGGTGG - Intergenic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181471837 22:23145463-23145485 CATGGCAACGAGAGCCACGCGGG - Exonic
1181620150 22:24085436-24085458 CAGGGCAAGGAGGCGCAACCTGG + Intronic
1182662002 22:31931747-31931769 CAGGGCTTTGAGGGGCACATAGG + Intergenic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1183470182 22:38001121-38001143 CAGGGCAAAGAAGGGCTCTCAGG - Intronic
1184020036 22:41814622-41814644 CAGGGCTAGGAGGGGCAGGAAGG + Intronic
1185164866 22:49255356-49255378 CAGGGCAGGGAGGGGCCCCCGGG - Intergenic
1185370412 22:50458386-50458408 CTGGGCACTGAGGGGGACACGGG + Intronic
951200872 3:19874352-19874374 AAAGGCAATGTTGGGCACGCTGG - Intergenic
952970832 3:38649409-38649431 CGGGGCAGGGAGGAGCACGCAGG + Intronic
954135838 3:48581740-48581762 CAGGGAGATGTGGGGCCCGCTGG - Exonic
959831025 3:110862554-110862576 CAGGGCACTGTGGGGCATGGTGG - Intergenic
962401838 3:135067300-135067322 AAGGGCAATGAGGTGGAGGCAGG + Intronic
962739452 3:138352303-138352325 CAGGGCAAGGAGGGCCAGGGTGG - Intronic
964953239 3:162323407-162323429 AAAGGCAATGTTGGGCACGCTGG + Intergenic
966142940 3:176776841-176776863 AAGGACAATGAGTGCCACGCTGG + Intergenic
966401690 3:179553926-179553948 CTGGGCAATGTGGCTCACGCCGG - Intergenic
966802902 3:183781265-183781287 CATGGGAGTGAGGGGCACACTGG + Intronic
967108210 3:186270866-186270888 GAGGCCAATGAGGGGCCAGCAGG - Intronic
967623396 3:191660855-191660877 AAAGGCAATGTTGGGCACGCTGG + Intergenic
968512201 4:1000724-1000746 CAGGGCAAGGGGGTGCAGGCGGG - Intronic
968902417 4:3437937-3437959 GAGGGTGAGGAGGGGCACGCTGG + Intronic
969551284 4:7869310-7869332 CACGGCACTGAGGAGCATGCAGG - Intronic
969589796 4:8115235-8115257 CAGGGCACTGAGGGCCAGGGTGG - Intronic
969860099 4:10028878-10028900 CAGGGCGGTGAGGGGCACAGAGG - Intronic
979495704 4:121380474-121380496 CAGGGCGAAGATGAGCACGCCGG + Exonic
981037523 4:140187805-140187827 CAGGGCAATGACAGGCACAGGGG + Intergenic
981067250 4:140498207-140498229 CAGGGCCATGAGGACCAAGCAGG - Exonic
984320531 4:178190200-178190222 CAGGGAAAAGAAGGGGACGCAGG + Intergenic
985016245 4:185638712-185638734 CAGGGCATTGGGGGGCTCTCAGG + Intronic
987903903 5:24050921-24050943 CAGGGCAGTGAGCGTCCCGCTGG - Intronic
988422502 5:31023740-31023762 TAGGGTAATGAGGGGTACCCAGG + Intergenic
988457214 5:31396910-31396932 AAAGGCAATGTTGGGCACGCTGG - Intergenic
990892136 5:60661202-60661224 AAAGGCAATGTTGGGCACGCTGG + Intronic
992366091 5:76091443-76091465 CTGGGCAGTGAGAGGCAGGCTGG - Intronic
996088401 5:119326964-119326986 CAGGACAATGGAGGGCACACGGG - Intronic
998148572 5:139744469-139744491 CGGGGGAATGAGGGGCATGGGGG - Intergenic
998570192 5:143250202-143250224 CCTGGCAATGAGGGGCCTGCTGG + Intergenic
999671223 5:153960533-153960555 CAGGACAATCAGGCACACGCTGG - Intergenic
1002132101 5:177087805-177087827 AAGAGCAATGAGGGGCACAGAGG + Intronic
1002644011 5:180644312-180644334 CTGTGCACGGAGGGGCACGCCGG + Intronic
1003336816 6:5181327-5181349 CAGGGCAATGAGGGGAAAGTAGG - Intronic
1003650202 6:7952254-7952276 AACAGCAATGAGGGGCAGGCAGG + Intronic
1004428481 6:15522687-15522709 CAGGTCATTGAGGGCCACCCCGG - Intergenic
1006377899 6:33681842-33681864 CAGGGCAATGAGGGTGATGGGGG + Intronic
1006847156 6:37070578-37070600 CAGAGCACTGAGGGGAAGGCTGG - Intergenic
1010893317 6:81339427-81339449 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1011540049 6:88419114-88419136 AAAGGCAATGTTGGGCACGCTGG - Intergenic
1011540083 6:88419297-88419319 AAAGGCAATGTTGGGCACGCTGG - Intergenic
1011754476 6:90484655-90484677 CAGCACAATGACAGGCACGCTGG + Intergenic
1012497798 6:99853684-99853706 GAAGGCAATGAGGGCCAAGCTGG - Intergenic
1013022059 6:106230404-106230426 AAAGGCAATGTTGGGCACGCTGG + Intronic
1013372607 6:109483396-109483418 CAGGGCAAGGCGGGGCGCGAAGG + Intergenic
1015873531 6:137800549-137800571 CAGGGCAGAGAAGGGCAGGCAGG - Intergenic
1016343362 6:143085477-143085499 AAAGGCAATGTTGGGCACGCTGG - Intronic
1018608660 6:165625130-165625152 CAGGGCAATGGGGAGGACTCTGG + Intronic
1019488240 7:1299253-1299275 CAGGCCACGGAGGGGGACGCAGG - Intergenic
1020507995 7:9018147-9018169 AAAGGCAATGTCGGGCACGCTGG + Intergenic
1021393220 7:20119860-20119882 AAGGCCAATGAGTGGCAGGCTGG - Intergenic
1023022479 7:36022457-36022479 AAAGGCAATGAGATGCACGCTGG - Intergenic
1023042003 7:36180454-36180476 AAGGCCAAGGAGGGGCACGATGG - Intronic
1028588754 7:92475539-92475561 AAAGGCAATGTTGGGCACGCTGG - Intronic
1028621919 7:92835368-92835390 CAGGGCAGTGCGGGGCCCGGCGG - Intronic
1028773589 7:94655743-94655765 CAGAGCAGGGAGGGGCCCGCGGG + Intronic
1029436668 7:100567652-100567674 CTGAGGAAGGAGGGGCACGCTGG + Exonic
1032391077 7:131555986-131556008 CCGGGCAAACAGGGGCGCGCCGG - Intronic
1032426208 7:131824123-131824145 AAAGGCAATGTTGGGCACGCTGG - Intergenic
1033561837 7:142539258-142539280 CAGGGCAGTAAGGGGCAGGCAGG + Intergenic
1034491772 7:151396636-151396658 CAGGGCAGAGTGGGACACGCTGG + Intronic
1034666166 7:152820188-152820210 CAGTGCCATGAGGGGCAGACAGG + Intronic
1034905975 7:154946637-154946659 CAGGGCAATGACGGACTCGCTGG + Intronic
1035230411 7:157462462-157462484 CGGGGAAATGAGGAGCTCGCGGG - Intergenic
1035242107 7:157538789-157538811 CAGTGCACGGAGGGGCACGGAGG + Intergenic
1036780394 8:11642869-11642891 GAGGGCACTGAGGGGAAGGCTGG + Intergenic
1037309820 8:17543443-17543465 CAGGGCAATGAGGTCCATGGTGG - Exonic
1037570901 8:20156943-20156965 AAAGGCAATGTTGGGCACGCTGG + Intronic
1037812677 8:22096286-22096308 TAGGGTAAAGAGGGGCACCCCGG - Intronic
1039782367 8:40797936-40797958 CAGGGCACTGAGGGGCTGGCAGG + Intronic
1041719758 8:60965296-60965318 GAGGGAAGTGAGGGGCACACGGG + Intergenic
1042202425 8:66292053-66292075 TGGGGCAATGAGGGTCACTCAGG + Intergenic
1042957941 8:74271814-74271836 CAGGGCAAGGAGGGGCCTGTGGG + Intronic
1048782227 8:138014876-138014898 CAGGGCAATGAGGAGCAGTCAGG + Intergenic
1049153845 8:141055266-141055288 CAGGGCCCTGAGGGCCAAGCTGG - Intergenic
1049176370 8:141195023-141195045 CGGGGAACTGAGCGGCACGCTGG - Exonic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049392481 8:142379390-142379412 CAGGGGGATGAGCCGCACGCTGG + Intronic
1049436621 8:142589112-142589134 CAGGGAACTGAGGTGCAGGCGGG + Intergenic
1049551879 8:143263834-143263856 CAGGGCACTGCGGGGCACAGGGG - Intronic
1049632539 8:143666422-143666444 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632558 8:143666520-143666542 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632580 8:143666618-143666640 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632612 8:143666764-143666786 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049743389 8:144251808-144251830 TAGGGGACTGAGGGGCACACAGG - Intronic
1050704518 9:8382015-8382037 TAGGGCTATGTGGGGCACCCAGG - Intronic
1052538632 9:29778523-29778545 AAAGGCAATGTTGGGCACGCTGG - Intergenic
1052595193 9:30549038-30549060 CAGGCCAATGGGTGGCAGGCTGG + Intergenic
1052940473 9:34128133-34128155 CAGTGCCAAGAGGGGCACACTGG + Intergenic
1055091371 9:72366828-72366850 CAGGGCACTGAAGGGCAGGGAGG + Intergenic
1057278005 9:93686461-93686483 CAAGGTAAGGAGGGGCACACAGG + Intergenic
1058539395 9:105995752-105995774 CAGGGCCAGGATGGGGACGCTGG + Intergenic
1058846585 9:108966486-108966508 GAGAGCACTGAGGGGCACGAGGG - Intronic
1059393838 9:114017983-114018005 CAGAGCAGTGAGGGGCAAGCAGG - Intronic
1059575791 9:115486901-115486923 CAGGACCATGTGGGGCATGCTGG + Intergenic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060583456 9:124771351-124771373 CAAGGCCCTGCGGGGCACGCTGG + Intergenic
1060807492 9:126586833-126586855 CAGGTCAATGATGAACACGCCGG - Intergenic
1061374651 9:130216753-130216775 CAGGGCCATTAGGGGCATCCTGG + Intronic
1061431341 9:130533271-130533293 CTGGGCAATGGGGGGCACCTGGG - Intergenic
1061645722 9:131999458-131999480 CAGGACAATGGGGGTCACCCTGG + Intronic
1061828376 9:133275401-133275423 CAGGGCCACGAGGGGCGCGCGGG - Intergenic
1062047888 9:134432796-134432818 CAGGGGAGTGAGAGGCACGGAGG + Intronic
1185758430 X:2670858-2670880 CAAGGCAAGGACGGGCACGGTGG - Intergenic
1186594270 X:10964183-10964205 CAGGGGAATGAGGAGCACCAAGG - Intergenic
1193306531 X:79958173-79958195 AAAGGCAATGTTGGGCACGCTGG + Intergenic
1196001901 X:110795620-110795642 CAGGGGAATTTGGGGCACCCTGG + Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196800523 X:119539242-119539264 CAGGGCAAGGCTGGGCACGGTGG + Exonic
1197763977 X:130047431-130047453 CAGGCCCATGAGTGGCACACAGG - Intronic
1199967282 X:152830884-152830906 CAGCGCGGGGAGGGGCACGCTGG + Intergenic