ID: 1132462201

View in Genome Browser
Species Human (GRCh38)
Location 16:61248-61270
Sequence GCGAAAACTTGGCGCCCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132462195_1132462201 1 Left 1132462195 16:61224-61246 CCTGCGGGTCCTGGCGCATGCAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1132462201 16:61248-61270 GCGAAAACTTGGCGCCCAGGTGG 0: 1
1: 1
2: 0
3: 3
4: 49
1132462198_1132462201 -8 Left 1132462198 16:61233-61255 CCTGGCGCATGCAGGGCGAAAAC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1132462201 16:61248-61270 GCGAAAACTTGGCGCCCAGGTGG 0: 1
1: 1
2: 0
3: 3
4: 49
1132462191_1132462201 22 Left 1132462191 16:61203-61225 CCGAGCGAATGAAGCTGTGCACC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1132462201 16:61248-61270 GCGAAAACTTGGCGCCCAGGTGG 0: 1
1: 1
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132462201 Original CRISPR GCGAAAACTTGGCGCCCAGG TGG Exonic