ID: 1132462572

View in Genome Browser
Species Human (GRCh38)
Location 16:62715-62737
Sequence CAGGGTGGACACAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 629}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132462566_1132462572 -3 Left 1132462566 16:62695-62717 CCTGAGCAAACACATGAGGTCAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG 0: 1
1: 0
2: 3
3: 66
4: 629
1132462564_1132462572 1 Left 1132462564 16:62691-62713 CCTTCCTGAGCAAACACATGAGG 0: 1
1: 0
2: 1
3: 19
4: 158
Right 1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG 0: 1
1: 0
2: 3
3: 66
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132462572 Original CRISPR CAGGGTGGACACAGGCAGGA AGG Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900539881 1:3197328-3197350 CTGGGGGCACACAGGAAGGAGGG - Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
901052010 1:6429998-6430020 CAGGCTGGGCTCACGCAGGAGGG + Intronic
901058961 1:6462909-6462931 CAGGGTGGCCCCAAGCAGGAGGG + Exonic
901102501 1:6729828-6729850 CAGCGTGGACGTGGGCAGGAGGG + Intergenic
901127443 1:6939569-6939591 CAGGCTGGAGACAGAGAGGACGG - Intronic
901840349 1:11950283-11950305 CAGTGAGGGCACAGACAGGAGGG - Intronic
901920074 1:12529709-12529731 AAGGGTGGACCCAGGAAGGATGG - Intergenic
902206099 1:14869179-14869201 AAGGGTCAAGACAGGCAGGAAGG - Intronic
902333723 1:15743157-15743179 CAGCGTGGACACGGCCCGGAGGG - Exonic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
902711360 1:18242162-18242184 CAGAGATGACACAGGCAGCACGG + Intronic
903061323 1:20670727-20670749 GAGGGTGGGGACAGACAGGAAGG + Intronic
903243863 1:22001726-22001748 CAGGGAGCACACAGACAGGTTGG - Intronic
903335547 1:22621984-22622006 CTGGGTGGACCCTGGCAGGAAGG - Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
905098653 1:35498568-35498590 CAGAGTGGAGGCAGGGAGGAAGG - Intronic
905400737 1:37701235-37701257 CAGGGTGGACACTAGAGGGAGGG + Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905805999 1:40877986-40878008 CAGGGTTGGACCAGGCAGGAAGG + Intergenic
906399821 1:45496676-45496698 CAGGCTGGTCACAGGCAGGGAGG - Intronic
906535449 1:46548641-46548663 CAGCGTGGACACTGGAATGAGGG - Intronic
906574640 1:46876770-46876792 CAGGATGGTTACAGTCAGGATGG + Intergenic
906597333 1:47091134-47091156 CAGGATGGTTACAGTCAGGATGG - Intronic
906838462 1:49109493-49109515 CTGAGTGGACACTGGGAGGAAGG - Intronic
907268847 1:53278674-53278696 TTGGGTGGGGACAGGCAGGAAGG - Intronic
907272773 1:53300525-53300547 CAGGGTGGGCACAGCCTGGAAGG - Intronic
907459377 1:54596259-54596281 CAGGGTGGGGGCAGACAGGAGGG - Intronic
907486022 1:54778696-54778718 AAGGGTGGACAAAGGCACCAAGG + Intergenic
907575618 1:55523221-55523243 CAGACAGGACCCAGGCAGGAGGG - Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911357836 1:96843729-96843751 CAGGGTGGAGATAGACAGGCAGG - Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
912385047 1:109267291-109267313 GTGGCTGGAGACAGGCAGGATGG + Intronic
912432984 1:109639285-109639307 CTGGGTGGACAGATGCAAGATGG + Intergenic
913156133 1:116100459-116100481 CAGGGAGGAGGCAGGAAGGATGG - Intergenic
913329412 1:117654659-117654681 AAGGCTGAAAACAGGCAGGAAGG + Intergenic
915300202 1:154947398-154947420 GCAGGTGGGCACAGGCAGGAGGG - Exonic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915657640 1:157375020-157375042 TAGGGTGGGCAGATGCAGGAGGG - Intergenic
915930028 1:160054661-160054683 CAGAGCTGACACAGGAAGGAGGG - Intronic
916492741 1:165316213-165316235 CACAGTGCACACAGGCATGAAGG + Intronic
916742443 1:167658181-167658203 GAGGCTGGACACAGGGAGGGGGG - Intronic
916951526 1:169785202-169785224 GGGGGAGCACACAGGCAGGAAGG + Intronic
917697595 1:177542422-177542444 CAGGGTGGAGACTGGGAAGAGGG + Intergenic
918097296 1:181345876-181345898 GAGAGTGGCCACAGGAAGGAGGG + Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918396735 1:184121096-184121118 CAGAGAGGACATTGGCAGGAAGG + Intergenic
919015222 1:192024894-192024916 GAGGGTGGAGAGAGGAAGGAGGG - Intergenic
919344467 1:196357630-196357652 AAGGGAGGAAACAGGCAGGGTGG + Intronic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
919899584 1:202034265-202034287 CAGCTGGGACCCAGGCAGGATGG + Intergenic
920173283 1:204084596-204084618 GAGGGAGGCCACAGGCAGGCAGG + Intronic
920190586 1:204191123-204191145 CAGGCTGCTCACAGCCAGGAAGG - Intronic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920347266 1:205314281-205314303 CAGGGAGGACAATGGCAGGCGGG + Intronic
920599274 1:207306541-207306563 CAGACTGGCTACAGGCAGGAAGG - Intergenic
921073766 1:211683811-211683833 CAAGGTGCAAACAGGCAGGAGGG - Intergenic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
922079702 1:222283842-222283864 GAGGGGGAACACAGGCAGGAAGG + Intergenic
922167958 1:223131321-223131343 CAGTGTAGATACAGCCAGGAAGG - Intronic
922242111 1:223762404-223762426 TAGGGAGGACACACGCAAGAGGG - Intronic
922340477 1:224650930-224650952 CAGCGTGGACACTGGCTTGATGG + Intronic
922702320 1:227769138-227769160 CAGGGGAGACACAGCCTGGATGG - Intronic
923219133 1:231876951-231876973 CTGGGTGGAGACAGGCCTGATGG + Intronic
923567587 1:235088090-235088112 CAGCCTGGACACTGGCAGAATGG + Intergenic
923661005 1:235957207-235957229 AGGGGTGGAAACAGGCGGGAAGG + Intergenic
1063173640 10:3532703-3532725 CAGGGTGGGGACAGGCAGGTGGG - Intergenic
1064240203 10:13620561-13620583 CAGGCTGGGAACAGGCATGAAGG - Intronic
1064259666 10:13775134-13775156 AAGAGAGGACACAGGCAAGAGGG + Intronic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065822228 10:29536253-29536275 GAGGGAGGAGAGAGGCAGGAGGG + Intronic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067151410 10:43738003-43738025 CAGGGTGGAGGCAGGCAGACAGG + Intergenic
1067678705 10:48411830-48411852 GAGGGTGGAGAAAGGAAGGAAGG - Intronic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069240554 10:66132898-66132920 AAGGGTGGACGGTGGCAGGAGGG + Intronic
1069959364 10:72070548-72070570 GAGGGTGGGCAGGGGCAGGAAGG - Intronic
1070649042 10:78221867-78221889 CAGGAGGGAGACAGGCATGAAGG - Intergenic
1070828813 10:79406400-79406422 CAGGGGGGTCGCAGGGAGGAAGG + Intronic
1070858652 10:79630148-79630170 CAGCCTGGACAAAGGCTGGAAGG + Intergenic
1072100699 10:92226798-92226820 CAGGGAGGAGACCTGCAGGAGGG + Intronic
1073146712 10:101286001-101286023 CTAGGAGGCCACAGGCAGGAGGG - Intergenic
1073191721 10:101655974-101655996 CATGGTGGGGACAGGCAGAAAGG + Intronic
1075474898 10:122726115-122726137 CAGGGTGGCCTCAGGTAGGGAGG - Intergenic
1075482190 10:122791349-122791371 CAGGGTGGAGAAAGGCAGGTTGG - Intergenic
1075715354 10:124552142-124552164 CAGGGTGGGGAAAGGCTGGAGGG - Intronic
1076135000 10:128039718-128039740 GAGGGAGGCCTCAGGCAGGAGGG + Intronic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076521674 10:131085120-131085142 CTGTGGGGACACAGCCAGGAGGG + Intergenic
1076761699 10:132608963-132608985 CAGGCAGGACACAGGCCCGAGGG - Intronic
1076818023 10:132924173-132924195 CAGGGTGGACCATGGCAGGCAGG - Intronic
1076818032 10:132924206-132924228 CAGGGTGGACCATGGCAGGCAGG - Intronic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1076904955 10:133357056-133357078 AAGGGTGCAGACAGGCAGGCGGG - Intronic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077066065 11:641378-641400 CAGGGTGCAGACAGGCAGCTTGG - Intergenic
1077182107 11:1221376-1221398 CACAGAGGACAAAGGCAGGAGGG - Intergenic
1077250579 11:1558949-1558971 CACGCTGGGCACAGGCAGGCAGG + Exonic
1077299305 11:1839817-1839839 GAGGGAGGACGCAGGCAGGACGG - Intronic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1078444795 11:11395996-11396018 GAGGGGGGACACAGCCAGGTGGG + Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079702351 11:23564483-23564505 CAGGTTGGAAACAGATAGGAAGG + Intergenic
1080281736 11:30565101-30565123 CAGGGGAGACACAGGCTGCACGG - Intronic
1080637895 11:34139501-34139523 CCGGGTGGGGACAGGGAGGAGGG + Intronic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080852558 11:36082598-36082620 CAGGGTGGTCACAGTCAAGAAGG - Intronic
1081296017 11:41390435-41390457 CAGGGTAGTGACAGGCAGGTGGG - Intronic
1082027644 11:47584602-47584624 TGGGGGGGACACAGGCAGGCAGG + Intergenic
1082985786 11:59170158-59170180 TAGGCTGGACATAGGCAGGTAGG + Intergenic
1083104444 11:60344599-60344621 CAGGATGGCTACAGTCAGGATGG - Intronic
1083270605 11:61570319-61570341 GAGGGTGGCCAGAGGCTGGAAGG + Intronic
1083280853 11:61626645-61626667 GAGGCTGGACACAGGCTGCAAGG - Intergenic
1083896870 11:65624459-65624481 CAGGGTGAACACTGGCAGGGAGG - Exonic
1084042255 11:66548994-66549016 CAGGGAAGCCTCAGGCAGGAGGG - Intronic
1084272898 11:68038585-68038607 CAGGGTGGTCAAGAGCAGGAAGG + Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084785086 11:71437532-71437554 CAGTGCGGGCACTGGCAGGAGGG - Intronic
1084887242 11:72218779-72218801 CAGGGAGGAGAAAGTCAGGATGG + Intronic
1085320668 11:75572089-75572111 CAGGGTGCACACAGGATGGCAGG + Exonic
1085387409 11:76164967-76164989 CAGGGGGGACACAGGCACGGGGG + Intergenic
1085387427 11:76165050-76165072 CAGGGGGGACACACACAGCAGGG + Intergenic
1085387436 11:76165099-76165121 CAGGGAGGACACAGGCACGGAGG + Intergenic
1085387476 11:76165248-76165270 CGGGGGGGACACAGGCACGGGGG + Intergenic
1085387529 11:76165465-76165487 CAGGGAGGACACACGCACGGGGG + Intergenic
1089209659 11:116791623-116791645 CAGCGGGGACAAAGGCAGGGTGG - Exonic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1089755290 11:120681746-120681768 CAGGCTGGGAACAGGCAGGAAGG + Intronic
1090024968 11:123159674-123159696 CAGGGGGCACACAGGAAGGGTGG + Intronic
1090270111 11:125380107-125380129 GAGCGCGGACACAGGCAGGCAGG - Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091198349 11:133750837-133750859 CAGGGAGGAGAGTGGCAGGAAGG + Intergenic
1091206445 11:133824487-133824509 CAGGAAGGACTCAGGAAGGAGGG - Intergenic
1091347856 11:134867224-134867246 CTGGGGGGATAAAGGCAGGAGGG + Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091794064 12:3287345-3287367 CAGGGTGGAGGCAGGCGTGAGGG + Intergenic
1091879536 12:3965750-3965772 CAGGAAGGCCACAGGAAGGATGG + Intergenic
1092701155 12:11232256-11232278 AAGAGTGGACACAGACTGGAAGG + Intergenic
1093481637 12:19610080-19610102 GAGGGTGGAGACTGGGAGGAGGG - Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1094410475 12:30163364-30163386 CAGGGTGGAGACGGGGAGGTGGG - Intergenic
1095601343 12:44016422-44016444 CAGGTGGGACACAGGGAGAAAGG - Intronic
1096078344 12:48818458-48818480 CAGGGCGGATCCAGGCAGGGAGG - Intronic
1096235488 12:49923427-49923449 CAGGGAGCACGCAGGCAGGGTGG + Intergenic
1096402511 12:51318992-51319014 AAGGGTGGAGCCAGGGAGGATGG - Intronic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097326531 12:58283651-58283673 AAGAGTGGACACAGGGAGGCTGG - Intergenic
1097812895 12:64037438-64037460 CATGGTGGAGATATGCAGGATGG - Intronic
1098382597 12:69884492-69884514 GAGGGTGGACAGGGGCAGGGAGG - Intronic
1098411411 12:70188331-70188353 GAGGCTGGACACAGGCAAGTTGG + Intergenic
1100667294 12:96768785-96768807 GGAGCTGGACACAGGCAGGATGG + Intronic
1102007166 12:109596308-109596330 CAGGTGGGTCACAGCCAGGAAGG + Intronic
1102013492 12:109633059-109633081 AAGGGTGCAGGCAGGCAGGAGGG + Intergenic
1102565902 12:113797328-113797350 CAGGGCTGACACTGGCGGGAGGG + Intergenic
1103135066 12:118499804-118499826 CAATGTGGACACAGACAGGGAGG - Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103617195 12:122161824-122161846 GAGGGTGGAGGCGGGCAGGAGGG - Intergenic
1104495890 12:129238173-129238195 ATGGGTGCACACAGGCAAGACGG + Intronic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1105294923 13:19079698-19079720 CAGGGAGGTCACAGGCACGGTGG + Intergenic
1106192606 13:27466759-27466781 GAGGGTGGAGACAGGCCGGGTGG + Intergenic
1106400817 13:29428569-29428591 AAGGGAGGGGACAGGCAGGAGGG - Intronic
1107012228 13:35680552-35680574 CAGGGTGGCCAAAGTCAGGGTGG + Intergenic
1107400380 13:40063539-40063561 CTGTGAGGTCACAGGCAGGAAGG + Intergenic
1107938242 13:45363017-45363039 TGGGGTGGAGACAGGGAGGATGG - Intergenic
1108530903 13:51326145-51326167 GAGGGTGCATAAAGGCAGGAGGG - Intergenic
1109300282 13:60583943-60583965 CAGGTTGGTCACAGGCAGAGAGG - Intergenic
1112827555 13:103409094-103409116 CACAGTGGCCACAGACAGGACGG - Intergenic
1112952438 13:105016799-105016821 CAAGGTGGAAACATGCAGGCAGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113439565 13:110317525-110317547 GAGGCTGGACAGAGGCGGGAGGG + Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114057764 14:18988780-18988802 GAGGGTGGAGAGTGGCAGGAGGG - Intronic
1114104783 14:19412973-19412995 GAGGGTGGAGAGTGGCAGGAGGG + Intronic
1114375675 14:22144068-22144090 CAGGGTGGACTCAGAGTGGAAGG + Intergenic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116817720 14:49599154-49599176 CAGGGTGGAGATGAGCAGGAAGG - Exonic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1118680434 14:68236057-68236079 GAGGGTGGAGGGAGGCAGGAGGG + Intronic
1119715185 14:76854050-76854072 CCGGGTGGACTGAGGCTGGAGGG - Intronic
1119948578 14:78720623-78720645 GAGAGTGGACAGATGCAGGATGG - Intronic
1120245964 14:82007012-82007034 TAGGATGGAGAAAGGCAGGAAGG - Intergenic
1120769891 14:88367556-88367578 GAGGGTGGAGGCAGGGAGGAGGG - Intergenic
1120823062 14:88930790-88930812 CAGGCTGGCCACAGTAAGGATGG + Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121261562 14:92570011-92570033 CAGGGATGGCACAGGAAGGAAGG - Intronic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1122027102 14:98886047-98886069 CAGGGTGACCACAGGCTGCAGGG + Intergenic
1122039107 14:98969853-98969875 CATGATGGACACAAGCAGGAGGG + Intergenic
1122111117 14:99503207-99503229 CAGGGATGAAACAGGCAGCAGGG - Exonic
1122542208 14:102504914-102504936 CAGGCAGGACACAGGCTGGCGGG - Exonic
1122689831 14:103526929-103526951 AAAGGTGGGAACAGGCAGGAAGG - Intergenic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122920244 14:104876934-104876956 TGGGGTGGAAGCAGGCAGGAAGG + Intronic
1122920879 14:104879644-104879666 GGGGGTGGCCAGAGGCAGGAAGG + Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1125523393 15:40360461-40360483 AATGGTGGGCACAGTCAGGAAGG + Intronic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1125756544 15:42069216-42069238 CAAGGTGGAAACAGCCAGAAGGG + Intronic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126651155 15:50922523-50922545 CATGGTAGACACAGACAGCATGG + Intronic
1126893893 15:53237353-53237375 GAGGGAGGTTACAGGCAGGAAGG - Intergenic
1126923535 15:53555290-53555312 CACGGAGGACAGAGGCAGGGCGG + Intronic
1127147472 15:56039551-56039573 AAGGGTGGAGACAGCAAGGAAGG - Intergenic
1127762127 15:62149833-62149855 CAGGGAGGAGACAGGAAGGCAGG + Intergenic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128217493 15:65944543-65944565 CAGGCTGGGCCCAGCCAGGATGG + Intronic
1128304068 15:66586643-66586665 CAGCGTGGACTCAGGCAGGCTGG + Intronic
1128542168 15:68543773-68543795 CAGGAGGGACTAAGGCAGGAAGG - Intergenic
1129388099 15:75206903-75206925 CTGGGTGGCGACAGGCTGGAGGG - Exonic
1129518230 15:76169949-76169971 CAGGGTGGACACCATCAAGAAGG + Intronic
1129519763 15:76178252-76178274 CAGGGTGGAGACAGGAAGACTGG + Intronic
1129692728 15:77722981-77723003 CAGAGTGGAGACAGACAGGTCGG + Intronic
1129712286 15:77826498-77826520 CCGCGTGGAGGCAGGCAGGATGG - Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130098476 15:80873861-80873883 CAGGGAGCACACTGCCAGGATGG + Exonic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131049520 15:89337275-89337297 CAGGGTGTAGCCTGGCAGGAAGG - Intergenic
1131509943 15:93044382-93044404 CAGGGAGGCCACAGGCCAGAAGG + Intronic
1132243014 15:100275507-100275529 CAGGGTGGAGACAGAAAGAAAGG + Intronic
1132253443 15:100352057-100352079 CAGGGTGGACACAGTGGGAAGGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132467960 16:86313-86335 CAGGGTGGCCACAGACTGGGGGG + Exonic
1132549754 16:549485-549507 CAGGGTGGGCACGGGCGGCAGGG + Intronic
1132703564 16:1231748-1231770 CAGGCTGGTCCCAGGCAGGGTGG - Intergenic
1132704946 16:1239613-1239635 CAGGCTGGTCCCAGGCAGGGTGG + Intergenic
1132707953 16:1254647-1254669 CAGGCTGGTCCCAGGCAGGGTGG + Intergenic
1132903746 16:2271851-2271873 CAGGCTGTAGGCAGGCAGGAGGG - Intergenic
1133782795 16:8952814-8952836 GAGTGTGGTCACAGGCGGGAGGG - Intronic
1135134783 16:19879543-19879565 GAGGGCGAACACAGGCAGGCAGG + Intronic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136071547 16:27790715-27790737 CAGGCTGGACACAGGCTGGCAGG - Exonic
1136667441 16:31824573-31824595 CAGGGAGGTGACAGGCAGGCAGG + Intergenic
1137057877 16:35754046-35754068 CAGGGTGGACTCCCACAGGAAGG - Intergenic
1137270906 16:46901757-46901779 CAGGGGGGCCACAGCCAGGAGGG - Intronic
1137547096 16:49411768-49411790 CACCCTGGACCCAGGCAGGAGGG + Intergenic
1137746336 16:50822954-50822976 CAGAGTGGACACTGGCGGAAAGG + Intergenic
1137773966 16:51040680-51040702 CAGGGAGGAGGGAGGCAGGAAGG + Intergenic
1138161439 16:54758528-54758550 CTGGGTGGACACAGGCTGGCTGG + Intergenic
1138660030 16:58511401-58511423 CACTGTGGACAGAGACAGGATGG - Exonic
1139332654 16:66205539-66205561 AAGGGGGAAGACAGGCAGGAGGG + Intergenic
1139927817 16:70501058-70501080 CAGGGTGACCTCAGTCAGGATGG + Exonic
1140943978 16:79749969-79749991 CACAGTGGACAAAGGAAGGATGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141468366 16:84222009-84222031 CAGGCTGGACACAGTCAGCCTGG + Exonic
1141754811 16:85983922-85983944 CGGGGTGGTCACAGGCATGATGG + Intergenic
1142115278 16:88353070-88353092 CAGGGTGGTGCCAAGCAGGAGGG + Intergenic
1142118438 16:88373494-88373516 CAGGTGGGGCACAGGCAGGGTGG - Intergenic
1142347712 16:89564797-89564819 CAGGGAGGAAGCAGGCTGGAGGG - Exonic
1142766560 17:2067684-2067706 GAGGGTGGAGGCAGGGAGGAGGG + Intronic
1143473903 17:7192333-7192355 CAGAGGTGACACAGGCGGGAAGG + Intronic
1143752540 17:9039657-9039679 CATGGTGGAAAGGGGCAGGAGGG - Intronic
1146390120 17:32414379-32414401 CAGGGTGGGTACAGGGAGAATGG - Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146656785 17:34639161-34639183 CAGGGTGGGCAAATGCAGAAGGG + Exonic
1146985200 17:37209514-37209536 CAGGGTGGCTAAAGGCAGGCAGG + Intronic
1148713638 17:49700009-49700031 GAGGGTGGAGAAAGGAAGGAAGG + Intergenic
1148767410 17:50047259-50047281 CTGGGTGCTCCCAGGCAGGAAGG - Intergenic
1148980160 17:51566756-51566778 CAGTGTGGACGAAGGCAGGAAGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149549832 17:57532065-57532087 CCTGGTGGGCACTGGCAGGAAGG + Intronic
1150467041 17:65402847-65402869 CAGGGGAGAGACAGTCAGGAGGG + Intergenic
1150651812 17:67015366-67015388 CAGGGAGGGGACGGGCAGGAGGG + Intronic
1151464293 17:74274565-74274587 CAGGGTGTACAGAGGCTGCAGGG - Intronic
1151576872 17:74956879-74956901 CAGGGAGGACAAAGGCAGAAAGG + Intronic
1151653023 17:75481591-75481613 ATGTGTGGAGACAGGCAGGAAGG + Intronic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1151785810 17:76274369-76274391 CTGGGCTGACACAGGCTGGAGGG + Intronic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1151987827 17:77555620-77555642 CAGGGGGGAGCCAGGCAGGCAGG - Intergenic
1152002640 17:77656004-77656026 CAGGCTGGACAGAGGCTGCAGGG + Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152732683 17:81980341-81980363 CAGGGTGGGCAATGCCAGGAGGG - Intronic
1153571680 18:6479453-6479475 TAGGGTGGAAAGAGGTAGGAGGG + Intergenic
1155154044 18:23143730-23143752 GAGGGTGCAGGCAGGCAGGAAGG - Intronic
1155273854 18:24167220-24167242 CAGCATGGAGACAGGCAGGTTGG - Intronic
1156067866 18:33166921-33166943 GAGGGTGGAGGGAGGCAGGAGGG - Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157449717 18:47776277-47776299 CAGTTGGGACACAGGCAAGAAGG + Intergenic
1157528306 18:48401769-48401791 CAGGAGGGACCCAGGCGGGAGGG - Intronic
1157809001 18:50679850-50679872 CAGGAGGGACACAGGAAGGAGGG - Intronic
1160147448 18:76376773-76376795 TAGGGTGCACGCAGGCTGGAGGG + Intronic
1160182878 18:76650986-76651008 CATGGGAGACACAGGCAAGAAGG - Intergenic
1160345249 18:78127251-78127273 CAGGGTGGCTGCAGCCAGGAAGG - Intergenic
1160510268 18:79449658-79449680 CAGGATGGAGCCAGGCCGGAGGG + Intronic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1160854376 19:1209793-1209815 CTTGGTGGAGACAGGCAAGAAGG + Intronic
1161021553 19:2013811-2013833 CAGGGAGGACGCAGGGAGCAAGG + Intronic
1161028761 19:2048484-2048506 CTGGGTGAACCCAGGCGGGAGGG + Intronic
1161155035 19:2728094-2728116 CAGGCAGGTCACAGGCGGGAGGG - Intronic
1161431281 19:4233687-4233709 CAAGGGGGAGACAGGGAGGAGGG - Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161644504 19:5444725-5444747 CAAGGGGGAGACAGGGAGGAGGG - Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162044674 19:7990760-7990782 CAGGGCGGAGACAGAAAGGAAGG + Intronic
1163276369 19:16286762-16286784 CAGGATGGAGAGAGGCAGGCAGG - Intergenic
1164597496 19:29539835-29539857 AGGGGTGGAGACAGGCAGGAGGG - Intronic
1164726625 19:30469737-30469759 CATGATGGACATAGGCAGGTGGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165732358 19:38153988-38154010 CAGAGTGGACACACCCAGGCAGG + Intronic
1165746568 19:38233383-38233405 CAAGGGGGACACAGGCAGAGGGG + Intergenic
1165746625 19:38233551-38233573 CAAGGGGGACACAGGCAGAGGGG + Intergenic
1165746651 19:38233620-38233642 CAAGGAGGACACAGGCAGAGGGG + Intergenic
1166319158 19:42005811-42005833 CATGGTGGACTCGAGCAGGAAGG + Exonic
1166353012 19:42209525-42209547 CAGGATGTAGACAGGCAAGATGG + Intronic
1166699176 19:44872272-44872294 CAGTGTAGACAATGGCAGGAAGG - Intronic
1166985882 19:46659857-46659879 CGAGGTGCAGACAGGCAGGAAGG + Intronic
1167249699 19:48393459-48393481 CAGGCTGGGGACAGGCAGGCAGG - Intergenic
1167377510 19:49119740-49119762 CAGGGTGGGCGCTGCCAGGAGGG - Intronic
1167463420 19:49638212-49638234 CGGGCAGGACCCAGGCAGGAAGG - Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1168182883 19:54674744-54674766 CAGGATGGCTACAGTCAGGATGG + Intronic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
1168439201 19:56348984-56349006 CAGGATGGCTACAGTCAGGATGG + Intronic
1168484741 19:56751406-56751428 CAGAGTGGAAACAGGCAGTGGGG + Intergenic
1168699981 19:58432086-58432108 CAGAGTGGGCACAGGCAGATGGG - Intergenic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925152888 2:1627806-1627828 CGGGGTGGATACAGGCAGGCTGG + Intergenic
925274755 2:2640939-2640961 TAGAGGGGACAGAGGCAGGAGGG + Intergenic
925451115 2:3969781-3969803 CAGCTTGGCCACAGACAGGAAGG - Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926001872 2:9339835-9339857 CAGGCTGGACACAGAGAGGTGGG - Intronic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926052672 2:9754723-9754745 GAGGGTGGGCAGGGGCAGGAGGG + Intergenic
926842272 2:17094327-17094349 GAAGAGGGACACAGGCAGGAGGG - Intergenic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
927680039 2:25132991-25133013 GGCGGTGGACACAGGCAGGACGG + Exonic
927870379 2:26619296-26619318 CAGCGTGGAGACCGGAAGGAGGG + Intronic
928370334 2:30735906-30735928 CAGGGAGGGGAGAGGCAGGAGGG + Intronic
928608381 2:32965482-32965504 CAGGGTTTAGACAGGAAGGAGGG - Intronic
928982919 2:37155140-37155162 CAGGTTGGACAGAGGCAGTTGGG - Intronic
929546232 2:42856713-42856735 CAGGGTGGTTACAGGGTGGAGGG - Intergenic
930021642 2:47005209-47005231 CGGGCTGGACACAGAGAGGAAGG + Intronic
930664724 2:54090662-54090684 CAGGATTGGCAAAGGCAGGAAGG - Intronic
930747595 2:54900784-54900806 CAGGGTGGACAAGGGCAAAAAGG + Intronic
932112498 2:69013581-69013603 CAAGGGGGACGCAGGGAGGATGG + Exonic
932283898 2:70516927-70516949 CAGGGTGAACCCAGTCAGCATGG + Intronic
932425724 2:71633645-71633667 CTGGGTTGACATAGGCATGAAGG + Intronic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
932766246 2:74472330-74472352 CTTGGTGGAGACGGGCAGGAGGG - Intronic
934158351 2:89224656-89224678 CACAGTGGACACAGGTAAGAAGG + Intergenic
934208917 2:89957769-89957791 CACAGTGGACACAGGTAAGAAGG - Intergenic
934690391 2:96354175-96354197 CAGGGCCGACACAGACTGGAGGG - Exonic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
935191431 2:100781765-100781787 CTGGGTGGAGACAGGCAAGTAGG - Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935957044 2:108387597-108387619 CAAGGTGGTGACAGGCAGCAGGG + Exonic
936164113 2:110105264-110105286 CAAGGTGGCCACAGGCAGTGTGG + Intronic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936669512 2:114640604-114640626 GAGGGAGGACAGAGACAGGAGGG - Intronic
936778402 2:116002355-116002377 GAGGCTGGACACCGGGAGGAGGG - Intergenic
936921164 2:117690164-117690186 CAGGGTGGAGGCTGGGAGGAGGG + Intergenic
936965970 2:118127958-118127980 CATGGTGGGACCAGGCAGGAGGG + Intergenic
936966148 2:118129406-118129428 CATGGTGGCACCAGGCAGGAGGG - Intergenic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
937922251 2:127138615-127138637 CTGGGTGGAACCAGGGAGGAGGG - Intergenic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938176403 2:129135197-129135219 CCGTGTGGACACTTGCAGGATGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938289463 2:130141766-130141788 CAGGCAGGACACAGGAGGGATGG - Intronic
938306125 2:130255994-130256016 TAAGGAGGCCACAGGCAGGACGG - Intergenic
938467065 2:131531172-131531194 CAGGCAGGACACAGGAGGGATGG + Intronic
938673818 2:133610533-133610555 CAGGTTTAGCACAGGCAGGAGGG - Intergenic
938841398 2:135168324-135168346 CGGGCTGGAGACAGACAGGAGGG - Intronic
939284410 2:140110511-140110533 CAGAGTTGCCACTGGCAGGAAGG + Intergenic
939356868 2:141114147-141114169 GAGGGGGCACACAGGCAGGCAGG + Intronic
939651631 2:144769839-144769861 CCGGATGGACCCAGGCAGGAGGG - Intergenic
940041109 2:149361867-149361889 CATGGTGGAGAAAGGCAGGAGGG + Intronic
940272648 2:151908475-151908497 CAGGGTTGACAATGCCAGGAAGG - Intronic
940738076 2:157476148-157476170 GAGGGTGGAGACGGGGAGGAGGG + Intronic
941531630 2:166677971-166677993 CAGGGAGGACACTAGCAGAAAGG - Intergenic
942875931 2:180797534-180797556 AGGGGTGGAGAGAGGCAGGAGGG + Intergenic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
945896533 2:215488762-215488784 CAGGGTGGAGGCTGGAAGGAGGG + Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946189601 2:218001479-218001501 CAGGGGTGACACAAGAAGGATGG - Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946665095 2:222041210-222041232 CTGGGTTGACACAGACATGAAGG + Intergenic
947435586 2:230069300-230069322 CAGGGTGGAAACAAGAATGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947795014 2:232889146-232889168 CATGGTGGCCACATACAGGATGG - Intronic
947854105 2:233311660-233311682 CAGGAAGGACAGGGGCAGGATGG - Intronic
948046263 2:234947687-234947709 CAGAGTGGACCCAGGCAGAAGGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948211004 2:236193186-236193208 CCCGGAGGACACCGGCAGGATGG - Intergenic
948564966 2:238879127-238879149 CAGAGGGGACAGAGCCAGGAAGG - Intronic
948753418 2:240145095-240145117 CAGGCAGGACACAGCCAGGCAGG - Intergenic
1169400251 20:5273714-5273736 CAGTGGAGACACAGGCAGGTGGG - Intergenic
1169402534 20:5295247-5295269 AGGGGTGGGGACAGGCAGGATGG - Intergenic
1170984328 20:21244018-21244040 CCGAGGGGACACACGCAGGACGG + Intronic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171265599 20:23769606-23769628 TAGGGTGGACACAGGCATTTTGG + Intergenic
1172106520 20:32520354-32520376 CAGGGTGGAAACAAGCACCAGGG + Intronic
1172207714 20:33176290-33176312 CAGGTTTGACTCAGGCAAGAGGG + Intronic
1172215582 20:33233383-33233405 CTAGGTGGATCCAGGCAGGAGGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172299698 20:33840334-33840356 CGGGGGGGAAACAGGCAAGACGG + Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172785969 20:37469240-37469262 CAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1172827046 20:37798008-37798030 CAGAGTGAACGCAGGAAGGAGGG - Intronic
1173253612 20:41377422-41377444 CAGGCAGGACCCAGGCTGGAGGG + Intergenic
1173419321 20:42886934-42886956 CAGGGTGCACAAATGCAGGGAGG + Intronic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173624460 20:44462084-44462106 AAGGCTGAAGACAGGCAGGAGGG + Exonic
1174059093 20:47819754-47819776 GTGGGGGGACCCAGGCAGGAGGG - Intergenic
1175011061 20:55736531-55736553 GAGGGTGGAGGGAGGCAGGAGGG + Intergenic
1175752531 20:61509107-61509129 TAGGGTGGACCCAGGCACAAAGG + Intronic
1175799912 20:61795713-61795735 GAGTGTGGACTCAGGAAGGAGGG + Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1175928210 20:62481088-62481110 CAGGGTGGAGACTGGGGGGAGGG - Intergenic
1175933394 20:62503891-62503913 CAAGGTGGGCACAGGCACCAGGG + Intergenic
1175940406 20:62535154-62535176 GAGGGTGGGGACAGGCAGGCCGG + Intergenic
1176115702 20:63431032-63431054 CACGGGGGACACAGGCGGGCTGG + Intronic
1176937051 21:14879598-14879620 CAGGAATGACACAGCCAGGAAGG + Intergenic
1178351556 21:31875238-31875260 GAGGCTAGAGACAGGCAGGAAGG - Intronic
1178435528 21:32554739-32554761 CACTGTGGACACAGACAGAAAGG - Intergenic
1178488773 21:33034744-33034766 CACGGAGGACACACGGAGGAGGG - Intergenic
1179293671 21:40042076-40042098 CAGGGAGAACACAGCCAGGTCGG + Intronic
1179640614 21:42745228-42745250 CGGGGTGGGCGCAGGGAGGAAGG + Intronic
1179877788 21:44279965-44279987 GAGGGAGGAGACAGGCAGGGTGG + Intergenic
1179912159 21:44456123-44456145 CAGGGTGGACGCCAGGAGGACGG - Intronic
1179996298 21:44975962-44975984 CACGGGGCACACAGGCCGGAGGG + Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180476248 22:15711392-15711414 GAGGGTGGAGAGTGGCAGGAGGG - Intronic
1181090755 22:20470953-20470975 CAGTGAGGGGACAGGCAGGAAGG + Intronic
1181108829 22:20589882-20589904 CAGGGAGGACACAGGCCTGCAGG - Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181770126 22:25119181-25119203 CAGGGTGGACACAAGAATGAAGG - Intronic
1181809652 22:25395629-25395651 CAAGGTGGACAGAGCCTGGAGGG + Intronic
1182527851 22:30932750-30932772 CAGGGTGGAGAAAGGCAGTGAGG - Exonic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183004963 22:34893656-34893678 CAGAGTGTGCACAGCCAGGAAGG + Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183080760 22:35454541-35454563 GAAGGTGGACACAGTCAGGAGGG + Intergenic
1183343350 22:37294152-37294174 CAGGGTGGAGGCGGGCAGGGTGG + Intronic
1183343387 22:37294239-37294261 CAGGGTGGAGGCGGGCAGGGTGG + Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
1183607377 22:38873605-38873627 CAAGGTGGTCACTGGAAGGATGG - Intergenic
1183654602 22:39177303-39177325 CCGGGAGGGGACAGGCAGGAGGG + Intergenic
1183746853 22:39697170-39697192 AAGGGAAGACACAGCCAGGAGGG - Intergenic
1184101798 22:42344696-42344718 CAGGGAGGACTCAGGCGGGGCGG - Intergenic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184281936 22:43442348-43442370 CGAGGTGCACCCAGGCAGGAAGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184371945 22:44088213-44088235 CTGGGTTGGCACTGGCAGGAAGG + Intronic
1184756100 22:46516827-46516849 CGGGGTGGGGACTGGCAGGAAGG + Intronic
1184817362 22:46882186-46882208 TAGGGTGGACTCAGGCATCAGGG + Intronic
1185206468 22:49541772-49541794 TGGGCTGGACACAGGGAGGATGG - Intronic
1185224163 22:49643634-49643656 CGGCGTGGACACAGCCCGGAAGG - Intronic
949943559 3:9172921-9172943 CAGGGACGCCGCAGGCAGGAAGG + Intronic
950129059 3:10529339-10529361 CAAGGTGGTTACAGGCAGGAAGG - Intronic
950625497 3:14243786-14243808 ATTGGTGGACACAGGCAGGCCGG - Intergenic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
952492555 3:33886050-33886072 CATGGTGGTCACAGCAAGGATGG - Intergenic
953768248 3:45760334-45760356 AATGGTGGGCACAGGCAGCAGGG + Intronic
953891729 3:46756184-46756206 CACGGTGGCCACAGGCTGGTGGG + Exonic
954372208 3:50174812-50174834 AAGGGTGGAAGCAGGCAGGAAGG - Intronic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954533458 3:51340449-51340471 AAGAGTGGACACAGGCAAGTGGG + Intronic
954660384 3:52223941-52223963 CAGGGTGGGCACAGCCAAGAAGG + Exonic
954706414 3:52483155-52483177 CAGGGGGTAGGCAGGCAGGAAGG - Intronic
955039218 3:55298649-55298671 CAGGGTGGACGGAGGCATAATGG - Intergenic
955054814 3:55445846-55445868 GAGGGTGGACACTGGCTGGAAGG - Intergenic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
960052302 3:113250573-113250595 GACGGTGGACGCAGGCTGGACGG - Exonic
960688050 3:120313711-120313733 GAGGGAGGGCACAGGCAGGCTGG - Intergenic
960733445 3:120751226-120751248 TGGGGTGGGCAGAGGCAGGAGGG - Intronic
961207953 3:125102266-125102288 CAGGGTGTATGAAGGCAGGAAGG + Intronic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
961628377 3:128279207-128279229 AGGGGTGCAGACAGGCAGGAAGG + Intronic
963071484 3:141308676-141308698 CAGGGTGGAGACGTGAAGGAAGG + Intergenic
964611300 3:158618888-158618910 CAGTCTGGCCACAGGCAGTAAGG - Intergenic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965850658 3:173018884-173018906 CTGGGTTGTCACAGGCAAGAAGG + Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
967972858 3:195012150-195012172 CAGGGTGGCCAAGGACAGGAGGG + Intergenic
968078223 3:195828787-195828809 CAGGGAGGAAGGAGGCAGGAAGG + Intergenic
968983022 4:3860955-3860977 CGGGTTGGACACAGGGAGGCTGG - Intergenic
968983060 4:3861107-3861129 CAGCGTGGACACAGGAAGGCTGG - Intergenic
969015546 4:4101907-4101929 GAGAGTGGAGACAGACAGGATGG - Intergenic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
969365138 4:6689919-6689941 CAGGGTGGAGATGGGCTGGAGGG - Intergenic
969513831 4:7635205-7635227 CAGGATGCACCCACGCAGGATGG - Intronic
969621162 4:8279605-8279627 CAGGATGGAGACACACAGGAAGG + Intronic
969797606 4:9537997-9538019 GAGAGTGGAGACAGACAGGATGG + Intergenic
969855032 4:9992170-9992192 TTAGGTGGAGACAGGCAGGAAGG - Intronic
971032997 4:22661192-22661214 TAGGGTGGATACAGACTGGAAGG - Intergenic
971311063 4:25526073-25526095 CAGGCTGCCCGCAGGCAGGAAGG - Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
975493304 4:75011971-75011993 GAGTGTGGTCACTGGCAGGAGGG - Intronic
976427045 4:84916530-84916552 CAGTTTGTACTCAGGCAGGAGGG + Intronic
976511169 4:85910984-85911006 CGGAGTGGACACTGGCAGGAGGG + Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
977655400 4:99515545-99515567 GAGGGTGGAGACTGGGAGGAGGG + Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979109260 4:116730665-116730687 GAGGGTGGACAGTGGAAGGAAGG - Intergenic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
984070863 4:175110164-175110186 CATGGTGGACCCAGGCAGGCTGG - Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
984843739 4:184092473-184092495 TAGGGTGGCCACACGCAGCACGG + Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
985620672 5:953165-953187 CGGGGTGGGAAGAGGCAGGAGGG + Intergenic
985827359 5:2202657-2202679 CAGGGTGAACCCTGGCAGGTGGG - Intergenic
985887736 5:2693170-2693192 CAGGCTGGAAACTGTCAGGAAGG + Intergenic
987024507 5:13910701-13910723 TGTGGTGGACACAGGCGGGATGG - Intronic
987025263 5:13920754-13920776 CAGCGTGGACAAAGGCACGTGGG - Intronic
987210890 5:15682092-15682114 CAAGGTGGTCAGAGGCAGGGTGG + Intronic
987294364 5:16537047-16537069 CAGGGAGGAGGCAGGCAGGGTGG - Intronic
987848798 5:23322763-23322785 CAGGCTGGAAACTGGAAGGAGGG + Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988808626 5:34763795-34763817 CAGGGTGGATACAGGCAAATGGG + Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
991127647 5:63085710-63085732 CAGCGTGAAAACAGGCAGAAAGG - Intergenic
992620502 5:78587852-78587874 CAGGGAGGCCACAGCCAGAAGGG - Intronic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995008977 5:107236749-107236771 AATGGGGGACACAGGCAGGTAGG - Intergenic
995928679 5:117408256-117408278 CAGGGTGGAGAGTGGAAGGAGGG - Intergenic
997165934 5:131660176-131660198 CAGGGTGGACACAGTCTTGGTGG + Intronic
997259356 5:132454266-132454288 CAGGAGAGAGACAGGCAGGAGGG - Intronic
997567573 5:134901330-134901352 TGGGGTGGTCACTGGCAGGAGGG + Exonic
997835651 5:137191002-137191024 AAGGGTAGACACTGACAGGAAGG - Intronic
998093574 5:139384458-139384480 CAGTGTGGACACCGGCAGGCGGG - Intronic
998672735 5:144372054-144372076 CATGTTGGACACAAACAGGAAGG + Intronic
999378501 5:151103692-151103714 CCTGGTGGAGCCAGGCAGGAGGG + Exonic
1000974612 5:167751106-167751128 CAGGGTGGAGAGAGGAAGCAGGG + Intronic
1001639746 5:173236066-173236088 CAGGGAGGGCACGGGAAGGAGGG - Intergenic
1002192989 5:177488478-177488500 CAGGGAGGACCCCGGGAGGAAGG + Intronic
1002719164 5:181247273-181247295 AACGGTGGACCCAGTCAGGAAGG - Intronic
1003217939 6:4132176-4132198 AAGGGAGGACACACACAGGATGG + Intronic
1003274451 6:4637257-4637279 AAGGGTGGACACAGACAAAAAGG + Intergenic
1003279805 6:4681445-4681467 TAGGGTGGAGGTAGGCAGGAAGG - Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003694547 6:8390403-8390425 GAGGGTGGGCACAGGCTGGGTGG - Intergenic
1003911936 6:10750991-10751013 CAAGGTGGACTCAAGCAGGAAGG - Intronic
1004086187 6:12451807-12451829 TAGGGTGGAAGCAGTCAGGATGG + Intergenic
1005948316 6:30611679-30611701 CAGGGAGGAGGCAGCCAGGAAGG + Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007320093 6:41021946-41021968 GAGGGTAGTCACAGGCAGAAAGG + Intergenic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1007772390 6:44202054-44202076 CTGGGTGGAGACATGCAGAAGGG + Intergenic
1010127383 6:72448733-72448755 CAGGGTGGCAACAAGCAGAAAGG - Intergenic
1010569760 6:77463101-77463123 CAGGATGGACACAAGCAGGTCGG + Exonic
1012394749 6:98783742-98783764 AAAGGTGGACACAGTCAGGTTGG + Intergenic
1013746454 6:113352311-113352333 CAGGGTGGAGAAAGGTAGGGAGG - Intergenic
1014057355 6:117031975-117031997 AACAGTAGACACAGGCAGGAAGG - Intergenic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1017617266 6:156258750-156258772 CACTGTGGACACAGGCAGAGAGG - Intergenic
1018028363 6:159822832-159822854 CAAGCTCCACACAGGCAGGATGG + Intergenic
1018062556 6:160102228-160102250 CACAGAGGAGACAGGCAGGAGGG - Intronic
1018350290 6:162951378-162951400 CCAGATTGACACAGGCAGGAAGG + Intronic
1019067342 6:169313378-169313400 CAGGATGGACACAGGCTGAGTGG - Intergenic
1019096388 6:169584062-169584084 CAGGGTAGACATAGGCGGGGAGG - Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019401877 7:859451-859473 CAGAGGCCACACAGGCAGGAGGG + Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019644669 7:2122672-2122694 CAGGTGAGACTCAGGCAGGAAGG + Intronic
1019731004 7:2629673-2629695 CAGGGTACACACATGCAGGCAGG - Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021314039 7:19124167-19124189 TAGGTTGCAAACAGGCAGGAAGG + Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021967711 7:25937914-25937936 GAGGGTGGACAGTGGCAGAAAGG + Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022472903 7:30692655-30692677 AAGAGGGGAGACAGGCAGGAAGG + Intronic
1022599047 7:31739059-31739081 GAGGATGGAAACAGGCAGGTGGG - Intergenic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1022909327 7:34884878-34884900 CAGTGAGGGCACAGGCAGGAAGG - Intergenic
1023247582 7:38221850-38221872 CAAGGTGGACAATGGCTGGAGGG - Intronic
1024298087 7:47862375-47862397 GAGGGGAGACTCAGGCAGGAGGG + Intronic
1024475247 7:49802247-49802269 GAGTGTGGACACAGGCATGCTGG - Intronic
1024481997 7:49873325-49873347 CAAGGTGGACATAGGGAGAAGGG - Intronic
1025235814 7:57234272-57234294 CTGGGGGGACGCAGGCAGGAGGG + Intergenic
1027181806 7:75946000-75946022 CAGGGAGCACACAGGCTGGGGGG - Intronic
1027226472 7:76247061-76247083 CAGTGTGGACACAGGCTGGAGGG + Intronic
1027234125 7:76287607-76287629 CAGGGTGGACATAGGCACAGGGG + Intergenic
1027442850 7:78238710-78238732 AAGGATGGAAACAGGCAGGCAGG - Intronic
1029097947 7:98104113-98104135 CAGGACAGACACTGGCAGGAGGG + Intergenic
1030077109 7:105746226-105746248 CAGTGTAGACACAGGAAGGGTGG - Intronic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031670211 7:124533599-124533621 CATGGTGGACAAAGGAAGGGAGG + Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1034240052 7:149603448-149603470 CAGGGAAGACACAGGCACGGGGG + Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035091754 7:156318876-156318898 CATGGAGCACACAGCCAGGAAGG + Intergenic
1035327877 7:158076487-158076509 TGAGGTGGACACAGGCAGGTTGG - Intronic
1035601851 8:901935-901957 CAGGGAGGAAACTGGCTGGAGGG + Intergenic
1035679733 8:1479098-1479120 CAGGGTGAGCCCAGGCAGGGGGG + Intergenic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036586770 8:10131715-10131737 CAGGGTGGACACTGGCCATAGGG - Intronic
1036642465 8:10592931-10592953 CAGGGTGGAGAGGGGCTGGATGG - Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037920187 8:22800548-22800570 CAGGGTGGGCACAGCAATGAGGG - Intronic
1038055485 8:23853832-23853854 CAGGAGGGAGACAGGCAGCAGGG + Intronic
1038763699 8:30408136-30408158 AAGGGTCTAGACAGGCAGGATGG - Intronic
1038856885 8:31343790-31343812 CTTCATGGACACAGGCAGGATGG + Intergenic
1039129756 8:34249689-34249711 CAGGGTGGAGCCAGGTAGGGTGG - Intergenic
1040565133 8:48558170-48558192 CAGGGAAGGCACAGGCAGGGTGG - Intergenic
1040593613 8:48818130-48818152 CACGGTGTGCACAGGCAGGTTGG + Intergenic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1042473074 8:69213493-69213515 CAGGGTTAATACAGGCAGGTTGG - Intergenic
1044118472 8:88364583-88364605 CAAGGCCGACACAGGCAGCAGGG + Intergenic
1044429819 8:92095655-92095677 AAGGAGAGACACAGGCAGGAGGG + Intronic
1047138013 8:122103442-122103464 TAGGTTGGAGACAGGAAGGAAGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047526870 8:125641365-125641387 AAGGGTGGACACAGACATAAGGG - Intergenic
1048215084 8:132486769-132486791 CAGGGAGACCACAGTCAGGATGG - Intergenic
1049148946 8:141022007-141022029 CAGGGTGACCACCGGCAGGACGG + Intergenic
1049442660 8:142616354-142616376 CTGGGTGGGCACATGCGGGACGG + Intergenic
1049566481 8:143341721-143341743 CAGGGTGGACGCTGGCAGTATGG - Intronic
1049576378 8:143391783-143391805 CAGGTGGGGCACAGGCAGGTGGG - Intergenic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1049673777 8:143880791-143880813 CAGGGCAGATGCAGGCAGGATGG + Intergenic
1052917301 9:33933212-33933234 GAGGGTGAAGACAGGTAGGAGGG + Intronic
1052963400 9:34319661-34319683 CAGGGTGCACACAGGATGGCAGG + Intronic
1053062507 9:35043330-35043352 CAGGTTGGACCTAGGTAGGAAGG - Exonic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056722482 9:89083550-89083572 CAGTGTGTAGACAGGCAGAAAGG + Intronic
1056762350 9:89424627-89424649 CAGGCAGGACACAGTGAGGAAGG - Intronic
1056768443 9:89459709-89459731 CCAGGTGGAGACAGGAAGGAAGG - Intronic
1057794104 9:98143401-98143423 CAGGGTGGAGACTGGGAGGCAGG + Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058606416 9:106728222-106728244 GAGGCTGGTCACAGGCGGGAAGG + Intergenic
1058935647 9:109767311-109767333 TAGGGTGGGCACAGGCCGGTGGG - Intronic
1060268410 9:122125592-122125614 CAGTGGGGCCCCAGGCAGGACGG + Intergenic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1061436408 9:130565540-130565562 CAGGTTGGCCACAGGAAAGAAGG + Intergenic
1061809178 9:133152545-133152567 CAGTGGGGACACAGGCAGACTGG - Intergenic
1061809190 9:133152582-133152604 CACTGGGGACACAGGCAGGCTGG + Intergenic
1061913569 9:133737765-133737787 CAGGGAGGTGGCAGGCAGGAGGG - Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062028089 9:134349759-134349781 CTGGGTGGACACCGCCAGGCTGG - Intronic
1062074307 9:134576065-134576087 CAGGGGAGGCCCAGGCAGGAAGG + Intergenic
1062158484 9:135067065-135067087 TGGGGGGGACACATGCAGGAGGG + Intergenic
1062205737 9:135335875-135335897 CTGGGTGGACACACGAAGGCTGG + Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062320228 9:135987001-135987023 CAGTGTGGACTCTGGCCGGATGG - Intergenic
1062333292 9:136053879-136053901 CAGGGCTGACACAGACAGCAAGG + Intronic
1062481392 9:136754108-136754130 CATGGAGGATGCAGGCAGGAGGG + Intergenic
1062525126 9:136975155-136975177 CAAGGTGGACAGGGGCAGGAGGG - Intergenic
1062702180 9:137913052-137913074 CAGTGGGGACACAGGAATGAAGG + Intronic
1185745083 X:2566199-2566221 CAGGGTGCATACAGACAGGATGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186486641 X:9938781-9938803 CCAAGTGGACCCAGGCAGGAGGG + Intronic
1187147552 X:16651242-16651264 GAGGGAGGACACATGCAGGTGGG + Intronic
1187333688 X:18363553-18363575 CAGGAAAGACACAGGCTGGAAGG - Intergenic
1187644155 X:21328501-21328523 CAGGGAGGGCACAGGCAGGTTGG - Intergenic
1190245757 X:48689063-48689085 CAAGGTGAGGACAGGCAGGATGG + Exonic
1192075783 X:67994712-67994734 GAGGGTGGAGGGAGGCAGGAGGG - Intergenic
1193491591 X:82156655-82156677 AAGGGGGGACATAGGCAGGTGGG - Intergenic
1195726424 X:107922158-107922180 CAGAATGGAGAAAGGCAGGAAGG - Intronic
1195861703 X:109390007-109390029 CAGCCTGCACACAGGAAGGAAGG + Intronic
1196031994 X:111101632-111101654 CAAGGAGGACACAGGAAGAATGG - Intronic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200746508 Y:6908904-6908926 CCGGTGGGATACAGGCAGGATGG + Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic