ID: 1132462572

View in Genome Browser
Species Human (GRCh38)
Location 16:62715-62737
Sequence CAGGGTGGACACAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 629}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132462566_1132462572 -3 Left 1132462566 16:62695-62717 CCTGAGCAAACACATGAGGTCAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG 0: 1
1: 0
2: 3
3: 66
4: 629
1132462564_1132462572 1 Left 1132462564 16:62691-62713 CCTTCCTGAGCAAACACATGAGG 0: 1
1: 0
2: 1
3: 19
4: 158
Right 1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG 0: 1
1: 0
2: 3
3: 66
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132462572 Original CRISPR CAGGGTGGACACAGGCAGGA AGG Intronic