ID: 1132463286

View in Genome Browser
Species Human (GRCh38)
Location 16:66101-66123
Sequence GTGGAGACCCAGATTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 334}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132463280_1132463286 3 Left 1132463280 16:66075-66097 CCCAGGGGGACCACACGGCGATT 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463270_1132463286 29 Left 1132463270 16:66049-66071 CCTGGCAGACCTGCAGCTGTCCC 0: 1
1: 0
2: 2
3: 27
4: 334
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463271_1132463286 20 Left 1132463271 16:66058-66080 CCTGCAGCTGTCCCCAACCCAGG 0: 1
1: 0
2: 2
3: 51
4: 362
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463276_1132463286 9 Left 1132463276 16:66069-66091 CCCCAACCCAGGGGGACCACACG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463281_1132463286 2 Left 1132463281 16:66076-66098 CCAGGGGGACCACACGGCGATTC 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463283_1132463286 -7 Left 1132463283 16:66085-66107 CCACACGGCGATTCCAGTGGAGA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463277_1132463286 8 Left 1132463277 16:66070-66092 CCCAACCCAGGGGGACCACACGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1132463279_1132463286 7 Left 1132463279 16:66071-66093 CCAACCCAGGGGGACCACACGGC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132463286 Original CRISPR GTGGAGACCCAGATTGAGAA GGG Intronic
900764190 1:4493034-4493056 GTGCCAACCCAGATTGAGGATGG - Intergenic
900819887 1:4878526-4878548 GTGCCCACCCAGATTGAGAGTGG - Intergenic
902761398 1:18583126-18583148 GAGGAGACCAAGATTCAGAGAGG - Intergenic
905133924 1:35783332-35783354 TTGGAGTCCCAGATGGAGAGGGG - Intergenic
905657351 1:39693171-39693193 TGGGAGGCCCAGAATGAGAAGGG - Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905934682 1:41813989-41814011 GAGGAGGCTGAGATTGAGAAAGG - Intronic
906578524 1:46913832-46913854 CTGCCCACCCAGATTGAGAATGG + Intergenic
908326343 1:63027615-63027637 GTGGACACCCAGATTGAGGGTGG - Intergenic
908827606 1:68148663-68148685 GAGGAAAACCAAATTGAGAAGGG + Intronic
909100775 1:71345216-71345238 GTGCCTACCCAGATTGTGAATGG + Intergenic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
909990969 1:82222269-82222291 GGGGAGACTCAGAGAGAGAAGGG - Intergenic
911763482 1:101643970-101643992 GTGCCCACCCAGATTGAGAGTGG - Intergenic
912981629 1:114379286-114379308 GTGGAGAACCAGATTAAAAAAGG - Intergenic
914938278 1:151999839-151999861 GTGGAGACCCAGGTTCATAGTGG - Intergenic
914957184 1:152173266-152173288 ATGAAGACCCAGATAGAGAAAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915308454 1:154994500-154994522 GAGGGGACCCAGCTTGAGTAGGG + Intergenic
917243550 1:172975255-172975277 GGGGAGACAGAGACTGAGAAGGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
919545607 1:198914393-198914415 GTTGAGATCCATTTTGAGAATGG + Intergenic
920009599 1:202858374-202858396 GAGGAGATCCAGATGCAGAAGGG + Intergenic
922175853 1:223196906-223196928 GTGGAGGCAGAGATTGGGAAAGG - Intergenic
923825421 1:237494472-237494494 GTGCCCACCCAGATTGAGGATGG + Intronic
923839583 1:237653956-237653978 GTGCCCACCCAGATTGAGAATGG + Intronic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1062897643 10:1116362-1116384 GTGGAGACCCAGGGTGAGGTGGG - Intronic
1063233638 10:4090204-4090226 CTGGATACCCAGGTTGAGAGAGG + Intergenic
1063673482 10:8118574-8118596 GTGGAGGCAGAGATTGGGAATGG + Intergenic
1064517266 10:16165274-16165296 GTGCACACCCAGATTAAGGATGG + Intergenic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064749453 10:18511776-18511798 GAGGGCACCCAGATTGAGAAGGG + Intronic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1066167494 10:32802913-32802935 GTGCCCACCCAGATTGAGAGTGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068238043 10:54263868-54263890 GTGCCCACCCAGATTGAGAGTGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069137328 10:64782299-64782321 GTGGGGATCCATATTGAGGACGG + Intergenic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1074026616 10:109642438-109642460 GAGGAGACCAAGAGTGAGACGGG - Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075913922 10:126149564-126149586 GTGCCCACCCAGATTGAGGACGG - Intronic
1077797574 11:5508266-5508288 GTGGAGACCAAGATGGTGCAGGG - Exonic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078558086 11:12347074-12347096 GTGGAGACAGAGATTGGGAGGGG - Intronic
1080098911 11:28436906-28436928 GTGCCCACCCAGATTGAGGATGG - Intergenic
1080798404 11:35587254-35587276 CAAGAGACCCAGATTGAGTATGG + Intergenic
1081616883 11:44596467-44596489 GGGGAGACCCTCATAGAGAAAGG + Intronic
1081893225 11:46562606-46562628 GTGGAGACACTTATTGAGAAGGG + Intronic
1085200026 11:74696319-74696341 GTGGAAACCAAGATCCAGAAGGG - Intergenic
1085539622 11:77254358-77254380 CAGGAGACCCACATAGAGAATGG - Intronic
1085788116 11:79472934-79472956 GAGGAGACTGAGATTCAGAAAGG - Intergenic
1085998116 11:81947157-81947179 GTGAAAATCCAGATTGAGGATGG - Intergenic
1088448897 11:109961665-109961687 GTGACCACCCAGATTGAGAGTGG - Intergenic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089418591 11:118314358-118314380 AGTGAGACCCAGATAGAGAATGG - Intronic
1090968223 11:131616729-131616751 GAGGAAACTCAGATTGAGACAGG + Intronic
1091573896 12:1714662-1714684 GTGGGGATCCACACTGAGAATGG + Intronic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1098869056 12:75796335-75796357 GTGGAGACCCTGATACATAAGGG - Intergenic
1099673986 12:85733128-85733150 GTGACCACCCATATTGAGAAGGG - Intergenic
1099697780 12:86043550-86043572 GTGCCCACCCAGATTGAGAATGG + Intronic
1101192662 12:102351202-102351224 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1101492336 12:105221390-105221412 GTGGAGACTAAGCTTCAGAAAGG + Intronic
1101492502 12:105222498-105222520 GTGGAAGGCCAGATGGAGAACGG + Intronic
1101607134 12:106255995-106256017 AAGGTGACCCAGCTTGAGAATGG + Intronic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1106563720 13:30868238-30868260 GAGGACACCCAGGTTTAGAAAGG - Intergenic
1106862918 13:33930523-33930545 GTGCCCACCCAGATTGAGGATGG + Intronic
1106945303 13:34820866-34820888 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1107973914 13:45671245-45671267 GTTGAGATCCTTATTGAGAAAGG - Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1110189849 13:72717695-72717717 GTGAAGACCCAGATGGAAATGGG - Intronic
1110636578 13:77774063-77774085 GGGGAGACCCAGGTGCAGAAAGG + Intergenic
1110948109 13:81450054-81450076 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1111722686 13:91966494-91966516 GTGCAGACAGAGATTGAGACAGG + Intronic
1111802353 13:92996407-92996429 GTGCCCACCCAGATTGAGGATGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113096236 13:106666922-106666944 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1113140739 13:107146484-107146506 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1113731387 13:112644220-112644242 GTGTAGAGCCAGAGTGAGACGGG + Intergenic
1113831964 13:113302822-113302844 GCGGAGACCTAGATCTAGAAGGG - Intronic
1114536972 14:23429117-23429139 GGAGAGACCCATATTGAGCAGGG + Intronic
1114554721 14:23555485-23555507 TTGGAGACCTAGATGGAGACAGG - Intronic
1116067810 14:40006983-40007005 GTGCCCACCCAGTTTGAGAATGG - Intergenic
1116636095 14:47397823-47397845 GAAGAGACCCAGATTAAGAGAGG + Intronic
1118440264 14:65805723-65805745 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118449697 14:65888850-65888872 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118750495 14:68804327-68804349 GTGGAGACCAAGATTTCAAAAGG - Intergenic
1119132302 14:72185217-72185239 GTGCCCACCCAGATTGAGAGTGG + Intronic
1119732367 14:76958922-76958944 GTGGAGCCCCAGGCTCAGAAGGG - Intergenic
1120888024 14:89467134-89467156 GTGGAGAGCCACCGTGAGAAGGG - Intronic
1121723657 14:96130338-96130360 ATGGGGAACCAGATTCAGAATGG + Intergenic
1125761235 15:42097028-42097050 GTGGAGACCCAAGGTGGGAAGGG + Intergenic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131951157 15:97683293-97683315 GTGGAGGTCCAGATTCAGTAGGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132677321 16:1126162-1126184 GTGGAAACCCAGTTTTAGACCGG + Intergenic
1133399753 16:5476865-5476887 TGGGAGAACTAGATTGAGAAAGG - Intergenic
1134132267 16:11657791-11657813 CTGGAGTCCCTGAGTGAGAAAGG - Intergenic
1134631472 16:15759272-15759294 GGGGAGAGCCTGCTTGAGAATGG + Intronic
1135968636 16:27055937-27055959 GAGGAAACCCAGACTGAGAAAGG + Intergenic
1136748727 16:32614561-32614583 GTGGAGGTCCACATGGAGAAAGG + Intergenic
1136915067 16:34181665-34181687 TTTGAGACCCACATTGAAAAAGG - Intergenic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1138278892 16:55757662-55757684 CTGGAGACCCAAATTCAAAAAGG - Intergenic
1138289642 16:55835926-55835948 CTGGAGACCCAAATTCAAAAAGG + Intergenic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138526078 16:57608034-57608056 GGGGAGACCAAGGTTCAGAAAGG - Intergenic
1139303582 16:65964773-65964795 GTGGAGAACCAGATTTTGTAAGG + Intergenic
1139632510 16:68239129-68239151 CTGGAGCCCTAGATAGAGAAGGG - Intergenic
1139822392 16:69730819-69730841 GTGCCCACCCAGATTGAGGATGG - Intergenic
1140887075 16:79253635-79253657 GTGGAGCCCAAGATGAAGAAAGG - Intergenic
1142165303 16:88583689-88583711 GTGGAGACCCGGCTTCAGATGGG + Intronic
1203050861 16_KI270728v1_random:873775-873797 GTGGAGGTCCACATGGAGAAAGG + Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1143451514 17:7039514-7039536 TTGGAGATCCAGATTGAGTCAGG - Intronic
1143667519 17:8373103-8373125 GTGGAGACGGAGATGGAGAGAGG - Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1147134617 17:38427937-38427959 GAGGAGACCCAGGATCAGAAAGG - Intergenic
1147451169 17:40505412-40505434 GTGAAGACACAGACTGAGACTGG - Intergenic
1148960452 17:51388191-51388213 GTGGCCACCCAGATTGAGGGTGG + Intergenic
1149123921 17:53204741-53204763 GTGGCCACCCAGATTGAGGGTGG - Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149207852 17:54268945-54268967 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1149254949 17:54815650-54815672 GTGCTGACCCAGATTAAGGATGG - Intergenic
1150964784 17:69955820-69955842 GTGCCCACCCAGATTGAGGATGG + Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151534252 17:74729759-74729781 GTGGAGCCCCAGAAGGAGATGGG - Intronic
1151958861 17:77394485-77394507 GAGGAGACCCAGTTTGACCAGGG + Intronic
1154410117 18:14135602-14135624 GTAGAGGTCCAGATTCAGAATGG - Intergenic
1155618240 18:27746049-27746071 GTGCACACCCAGATTGAGGGTGG - Intergenic
1157999258 18:52597051-52597073 GTGGAGACTCAGATTCAAAAGGG - Intronic
1158639551 18:59191914-59191936 GTGGAGACCACCATTGAGATAGG - Intergenic
1158933280 18:62341813-62341835 GAGGAGACTCAGGCTGAGAATGG + Intronic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159438280 18:68445972-68445994 GTGTCCACCCAGATTGAGGATGG - Intergenic
1159780679 18:72657191-72657213 GTGCACACCCAGATTGAGGCTGG - Intergenic
1160149534 18:76388565-76388587 TTGATGACCCAGATGGAGAAAGG + Intronic
1160703286 19:518190-518212 GGGGAGGCCCAGGTTGAGTAGGG + Intronic
1160703354 19:518355-518377 GGGGAGGCCCAGGTTGAGTAGGG + Intronic
1161684568 19:5696453-5696475 GGGGAGACCCCGAGTGAGAGCGG + Intronic
1161684971 19:5698083-5698105 GGGGAGTCCCAGATTGACTAGGG - Intronic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1163258959 19:16175161-16175183 GGTGAGACCCAAAGTGAGAAGGG - Intergenic
1163685108 19:18708195-18708217 GAGGAGACCCAGATCTGGAAAGG + Intronic
1163734155 19:18968540-18968562 GAAGAGACTCAGAGTGAGAAAGG - Intergenic
1163989570 19:20985839-20985861 GTGGAGCTCCAGGTTCAGAATGG + Intergenic
1164356207 19:27434029-27434051 CTTGAGGCCCATATTGAGAAAGG + Intergenic
1164553482 19:29232254-29232276 GTGGAGACCCCGGTTTAGACAGG + Intergenic
1166215593 19:41332387-41332409 AGGGAGACCCAGATGGAGATAGG - Intronic
1166459837 19:42977344-42977366 GTGCACACCCAAATTGAGGAAGG - Intronic
1166477161 19:43137398-43137420 GTGCACACCCAAATTGAGGAAGG - Intronic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167385583 19:49161099-49161121 GTGGGGACTGAGATTGGGAAAGG + Intronic
1167427660 19:49437714-49437736 GCAGAGACCCAGAGAGAGAAGGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
926283688 2:11470643-11470665 GTGCCCACCCAGATTGAGAGTGG + Intergenic
926909961 2:17843381-17843403 GGGGAGCCCTAGATTGTGAAAGG + Intergenic
929032713 2:37663824-37663846 GTGCCCACCCAGATTGAGGATGG - Intronic
929738750 2:44579746-44579768 GTGGAGACCAAGTTTTAGACAGG + Intronic
929881574 2:45841549-45841571 GTGCCCACCCAGATTGAGAATGG + Intronic
930997382 2:57736859-57736881 GTGCCCACCCAGATTGAGGATGG + Intergenic
932083927 2:68740517-68740539 AGGGAGACCCAGATGGAGAGAGG - Intronic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933335251 2:80949894-80949916 GTAGGGAAACAGATTGAGAAAGG - Intergenic
933840056 2:86279284-86279306 GGGAAGAGCAAGATTGAGAAGGG + Intronic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
935476981 2:103534745-103534767 GTGCCTACCCAGATTGAGGATGG - Intergenic
936029792 2:109062096-109062118 GGAGAGAAACAGATTGAGAAGGG - Intergenic
937773795 2:125752089-125752111 GTGGAGACCCAGATCAAGGGAGG - Intergenic
938765536 2:134458712-134458734 GAGGTTATCCAGATTGAGAAGGG + Intronic
938932578 2:136099708-136099730 GAGGAGACCCAGAGAAAGAAGGG - Intergenic
940612453 2:156007387-156007409 GTGGAGACTCAGCTTGGGATGGG - Intergenic
941283120 2:163577678-163577700 GTGCCCACCCAGATTGAGAGTGG - Intergenic
943170062 2:184386504-184386526 GTGCCCACCCAGATTGAGAGTGG - Intergenic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
944494251 2:200290541-200290563 GTAGAGAACGAGATAGAGAATGG + Intergenic
944584862 2:201164607-201164629 GTGCCCACCCAGATTGAGGATGG + Exonic
944586920 2:201180625-201180647 GAGGAAACCCAGATTCAGAGAGG - Intergenic
945008557 2:205436972-205436994 GTGGGGATCCAGCTTCAGAATGG - Intronic
945950615 2:216035440-216035462 GCTGACACCCAGATTGAGTAGGG - Intronic
947731314 2:232433092-232433114 GTGGAGAGCCAGGTTCAGATGGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948981634 2:241497698-241497720 GTGGAGGCCCAGGGTGAGCAGGG + Intronic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1170793813 20:19529458-19529480 ATGGAGACCCAGGTTGAAAGTGG - Intronic
1171485717 20:25484068-25484090 GGAGAGGCCCAGATGGAGAAGGG + Intronic
1173858509 20:46266853-46266875 CTGGAGCCCCAGATTCAGTAAGG + Intronic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174698040 20:52580029-52580051 GTGCCCACCCAGATTGAGGATGG + Intergenic
1174743475 20:53039173-53039195 GTGTAGACCAAGAAGGAGAAGGG - Intronic
1176271820 20:64239367-64239389 GTGGAGTCTGAGATTGAGACAGG + Intronic
1177228957 21:18294227-18294249 GTGGTGACCTAGTTTGGGAAGGG + Intronic
1177514785 21:22135197-22135219 GTGGCCACCCAGATTGAGGGTGG - Intergenic
1178167494 21:29996581-29996603 GTGCCCACCCAGATTGAGGACGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178686470 21:34715183-34715205 GTGGAGACCCAGAGCCATAAAGG - Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179487096 21:41717328-41717350 GTCGAGACCCTGATGGAGGAAGG - Intergenic
1180080509 21:45485671-45485693 GTGGAGACCCAGACCTAGAAGGG + Intronic
1180218158 21:46339673-46339695 GTGGCAACCCAGATTGAGGGTGG + Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1183453821 22:37910791-37910813 GTGGAGTCCCAGCTTGGTAAAGG - Intronic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
949147941 3:726187-726209 GTGGGGACTAAGAATGAGAAAGG + Intergenic
950249752 3:11454469-11454491 GTGGAGAGCCAGTTTGAGTATGG + Intronic
951035614 3:17928702-17928724 GTGGAAACCCAGATTTATAAGGG - Intronic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
951400678 3:22228727-22228749 GTGCTTACCCAGATTGAGAGTGG - Intronic
954854907 3:53635589-53635611 GCTGAAACCCAGATAGAGAAAGG - Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955499056 3:59565989-59566011 GTGCCCACCCAGATTGAGCATGG - Intergenic
956625659 3:71264050-71264072 CAGGAAACCCAGATTCAGAAAGG + Intronic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG + Intergenic
958806599 3:98818623-98818645 GTGCCGACCCAGATTGAGGGTGG - Intronic
960296518 3:115951581-115951603 GTGGCCACCCAGATTGAGGGTGG - Intronic
960619972 3:119628051-119628073 GAGGAGACTCAGAGTGAAAATGG - Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
963460824 3:145612874-145612896 GTGCCCACCCAGATTGAGAATGG - Intergenic
967204406 3:187106532-187106554 GTGCCCACCCAGATTGAGGATGG - Intergenic
970477407 4:16437594-16437616 GTGCCCACCCAGATTGAGGATGG + Intergenic
970579286 4:17460134-17460156 GTGGAAACTGAGGTTGAGAATGG + Intergenic
972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG + Intergenic
973035742 4:45403886-45403908 GTGTCCACCCAGATTGAGAGTGG + Intergenic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
974318210 4:60309487-60309509 GTGGAGGCCCTGCTTGACAAAGG - Intergenic
975051365 4:69868749-69868771 TTGGAGACCCGGATTCAGTATGG + Intergenic
975681252 4:76878783-76878805 GTGCCCACCCAGATTGAGGATGG - Intergenic
975696711 4:77021234-77021256 GTGGAGACGCAAAATGTGAAGGG + Intronic
976260049 4:83136778-83136800 CTGGGGACCCAGAGTGTGAAGGG - Intronic
977630193 4:99234355-99234377 GTGGAGACCAAGATTAGGAGTGG - Intergenic
978335898 4:107668519-107668541 GTGCCTACCCAGATTAAGAATGG - Intronic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
979383552 4:120036830-120036852 ATGGACACCCACAGTGAGAAGGG - Intergenic
980513779 4:133826388-133826410 GTGTCCACCCAGATTGAGACTGG - Intergenic
980896006 4:138861036-138861058 GAGGGGACCCAGGCTGAGAAGGG - Intergenic
982139038 4:152299777-152299799 GTTGAGAACCACACTGAGAAAGG - Intergenic
982278235 4:153658671-153658693 GTGGAGCCCTTGATGGAGAAGGG + Intergenic
982528931 4:156513809-156513831 TTGGAGATCCAGGCTGAGAAAGG + Intergenic
982770936 4:159396705-159396727 GTGTTGACCCAGATTAAGAGTGG - Intergenic
982839298 4:160161865-160161887 GTGGCCACCCAGATTGAGGGCGG + Intergenic
983472837 4:168177429-168177451 GTGGATACTCAGTTTGATAAGGG + Intronic
983969154 4:173849743-173849765 GTGCCCACCCAGATTGAGGATGG + Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985605751 5:857318-857340 ATGGAGTCCCAGTCTGAGAAGGG - Intronic
986286036 5:6359924-6359946 GTGGACACGCAGAGTGAGCACGG + Intergenic
989200968 5:38763391-38763413 GTGCCCACCCAGATTGAGGATGG - Intergenic
989652844 5:43712840-43712862 GGTGGGACACAGATTGAGAAAGG + Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
990822382 5:59857200-59857222 GTGTAAACCCAGATTGACCAAGG - Intronic
992712716 5:79476485-79476507 CTGGAGACCCAGACTGGCAACGG - Intronic
992954380 5:81892186-81892208 GTGTAGACCCAGCTAGAGAATGG + Intergenic
994369636 5:98953636-98953658 GTGCCCACCCAGATTAAGAATGG + Intergenic
994855849 5:105118152-105118174 GTGCCCACCCAGATTGAGGATGG - Intergenic
995259383 5:110084046-110084068 GTGGAGAGCAGGATGGAGAATGG - Intergenic
997524839 5:134545665-134545687 GTGGAGACTGAGATTCAGAAAGG - Intronic
997667481 5:135643297-135643319 GTTCAGCCCCAGACTGAGAAGGG - Intergenic
998316412 5:141187191-141187213 GTCGAGTCCCTGATTGGGAAAGG + Exonic
998800297 5:145862375-145862397 GTGGTAACCCAGAATAAGAATGG - Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999339772 5:150760016-150760038 GGGGAGTCCCAGTTAGAGAAAGG - Intergenic
999410446 5:151345581-151345603 GTGGACACCCACAGGGAGAAAGG - Intronic
999551015 5:152687243-152687265 GGGGAGAGTCAGGTTGAGAAAGG + Intergenic
1001128117 5:169039132-169039154 TTGTAGACCCAGTTTGAGGATGG + Intronic
1002285348 5:178159096-178159118 GTAGATACCCAGAATGAAAATGG + Intergenic
1003691797 6:8362129-8362151 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1004256318 6:14068007-14068029 GTGGAGACCCTGATCTACAAGGG + Intergenic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1009760415 6:67997814-67997836 GTGGACACCCTGTTTGAGAAGGG + Intergenic
1010749349 6:79600620-79600642 GTTCTGAACCAGATTGAGAATGG - Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012320601 6:97840114-97840136 GTGGAAACTAAGATTGAGAACGG + Intergenic
1013017122 6:106169970-106169992 TGGGAGAACCAGATTGACAATGG + Intergenic
1013839252 6:114370925-114370947 GTGCCCACCCAGATTGAGGATGG + Intergenic
1014328928 6:120035516-120035538 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1017228290 6:152044785-152044807 GTGCCCACCCAGATTGAGGATGG + Intronic
1018432758 6:163735871-163735893 GTGGAAACTGAGATTGAGGAGGG - Intergenic
1018564049 6:165132814-165132836 GTGCCAACCCAGATTGAGAGTGG + Intergenic
1020448622 7:8297102-8297124 GTGGAGACCGAGACTGGGAATGG - Intergenic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1021356595 7:19658529-19658551 GTGGAGATCCATACTGGGAACGG + Intergenic
1021489778 7:21207016-21207038 GTGGAGACACATCATGAGAAGGG - Intergenic
1023463704 7:40429688-40429710 GTGCACACCCAGATTGAGGGTGG + Intronic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1026494106 7:70887993-70888015 GTGGAGGGACAGATTGGGAAAGG + Intergenic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1028688934 7:93627494-93627516 GTGCCCACCCAGATTGAGAGTGG - Intronic
1030037707 7:105422112-105422134 GTGCCCACCCAGATTGAGGATGG + Intergenic
1030195941 7:106853688-106853710 GTGGTGACACTGTTTGAGAAGGG - Intergenic
1030360203 7:108587674-108587696 GTGCCCACCCAGATTGAGGATGG + Intergenic
1030450239 7:109700042-109700064 GTGATAACCCAGATTGAGGATGG - Intergenic
1030825230 7:114147831-114147853 GTGGAAACCCAGATTGGGAAGGG + Intronic
1033712599 7:143963860-143963882 GTGCCTACCCAGATTGAGGATGG + Intergenic
1034123190 7:148645735-148645757 GTGCCCACCCAGATTGAGGATGG - Intergenic
1034170336 7:149058002-149058024 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1036034031 8:4999775-4999797 GAAGAAACCCAGATGGAGAATGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036662531 8:10717085-10717107 GTGGAGGCCCAGACAGCGAATGG - Intergenic
1037501116 8:19486380-19486402 GGGAAGACCCAGTTTTAGAAGGG - Intronic
1037524755 8:19713855-19713877 GGGCAGCCCCAGATGGAGAAGGG + Intronic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1041106711 8:54452017-54452039 GAGGAGATTAAGATTGAGAAAGG - Intergenic
1045128853 8:99125409-99125431 GTGCCCACCCAGATTGAGGATGG + Intronic
1045393702 8:101739516-101739538 GTGCCCACCCAGATTGAGGATGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047751091 8:127881113-127881135 GTGGAGACCCACATTGTGTCTGG + Intergenic
1049790384 8:144469721-144469743 GTGGACACCCAGACTGGGAAGGG - Intronic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1055882952 9:81023864-81023886 GTGGCCACCCACATTGAGAGTGG - Intergenic
1056320348 9:85429601-85429623 GTAGAGACCCAGAAGAAGAATGG + Intergenic
1057452628 9:95178372-95178394 GTGGAGATCCAGGTTCAGAATGG + Intronic
1057741848 9:97718924-97718946 ATTGAGACCCAGACTGGGAAAGG - Intergenic
1058381303 9:104379792-104379814 GTGCCCACCCAGATTGAGCATGG - Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059578824 9:115521437-115521459 GTGCAGGGCCAGATTGTGAATGG + Intergenic
1059955866 9:119515413-119515435 GTGGAGACAGAGAGAGAGAAAGG + Intronic
1061406642 9:130396053-130396075 GTGGAGATCCACAGTGAGTAGGG + Intronic
1062231419 9:135484115-135484137 GTGGAAGCCCGGAGTGAGAAGGG + Intronic
1203406636 Un_KI270538v1:25779-25801 TTGGAGGCCCAGTTTGAAAAAGG + Intergenic
1185531098 X:819845-819867 GTGTAGACGCAGATGGACAAGGG - Intergenic
1186677191 X:11831132-11831154 GTGGGGAGCCAGATTGGGACAGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1188613016 X:32122420-32122442 GTGAAGACCTAGATTGTGACTGG - Intronic
1188848573 X:35104094-35104116 GTGCATTCCCAGATTGAGGATGG - Intergenic
1190305170 X:49077845-49077867 GTGGAGCCCTTGATGGAGAAGGG - Exonic
1190509522 X:51161798-51161820 GTGAAGACCCTGAGCGAGAATGG + Intergenic
1190545600 X:51523176-51523198 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1191148878 X:57198854-57198876 GTGAAAATCCAGATTAAGAAAGG - Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192625145 X:72719362-72719384 GTGAAGACCCAGGTGGAGATGGG + Intergenic
1192661279 X:73045304-73045326 GTGTCCACCCAGATTGAGAGTGG + Intergenic
1193484302 X:82067513-82067535 GTGCCCACCCAGATTGAGCATGG + Intergenic
1194230320 X:91314571-91314593 GTGCACACCCAGATTGAGGGTGG + Intergenic
1194477795 X:94380236-94380258 GTGCCCACCCAGATTGAGGATGG + Intergenic
1194702691 X:97133701-97133723 TTGAAGACCAAGAGTGAGAATGG - Intronic
1194823843 X:98537534-98537556 GTGCAGACCCAGATTGAGGGTGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195198291 X:102520209-102520231 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1195410718 X:104566064-104566086 GAGGGGAGGCAGATTGAGAAAGG - Intergenic
1195959948 X:110376035-110376057 GTGGAAACTGAGATTCAGAAAGG + Intronic
1196230754 X:113218124-113218146 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196512280 X:116525728-116525750 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic