ID: 1132463956

View in Genome Browser
Species Human (GRCh38)
Location 16:69073-69095
Sequence CTCTCTGAGGGGCAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132463950_1132463956 -6 Left 1132463950 16:69056-69078 CCTGTGGGTACTTGGCACTCTCT 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG 0: 1
1: 0
2: 5
3: 48
4: 433
1132463946_1132463956 13 Left 1132463946 16:69037-69059 CCATCACAGGGTGGTGTAGCCTG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG 0: 1
1: 0
2: 5
3: 48
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132463956 Original CRISPR CTCTCTGAGGGGCAGGAGCT GGG Intronic
900615335 1:3563138-3563160 CACTGTGAGGGGCCGGCGCTGGG - Intronic
901759681 1:11462617-11462639 CTCTCAGAGGGGAATGAGCAGGG - Intergenic
901807206 1:11746050-11746072 CTCACTGTGGGGCAGGCCCTGGG - Intronic
901931588 1:12599364-12599386 CTTTCTGTGGGGCTGGTGCTTGG - Intronic
902359776 1:15936014-15936036 CACCATGAGGGGCAGGAGCAGGG - Exonic
902993301 1:20204720-20204742 CAGTCTGATGGGCAGGAGGTAGG - Intergenic
903291180 1:22315271-22315293 CCATCTTAGGGGAAGGAGCTGGG + Intergenic
903650203 1:24917343-24917365 CTCTCTCATGGGCAGCAGCTGGG - Intronic
903697390 1:25217974-25217996 TTCCCTGATGGGCAGGAGCAGGG + Intergenic
904266099 1:29319317-29319339 CTGTCTGAGGGTCCTGAGCTGGG + Intronic
906192832 1:43909212-43909234 CTGACTGAGAGGCAGGAGTTTGG - Intronic
906816354 1:48883986-48884008 CCCTCTGAGGGACTGTAGCTGGG - Intronic
907044800 1:51294219-51294241 CTCTCTAAGGGGCAGGGGCTGGG + Intronic
907472962 1:54686161-54686183 CTCTCTGGGAGGTAGGATCTGGG - Intronic
907719351 1:56957136-56957158 CTCTCTGAGGGCAGGGACCTTGG + Intronic
909327722 1:74373110-74373132 CTCTCTGAGGGAAAGGACCCAGG - Intronic
911112431 1:94204382-94204404 CTCTCTGAAGGATAGGACCTAGG + Intronic
911253222 1:95604129-95604151 CTCTCTGAGGAGCAGGATGGCGG + Intergenic
912370101 1:109167256-109167278 CTCTCAGAGAGGCAGGATGTGGG + Intronic
912391588 1:109306848-109306870 TTCTATAGGGGGCAGGAGCTGGG + Exonic
913244575 1:116860354-116860376 TTCTCTGGTGGGCAGGAGTTGGG + Intergenic
915095621 1:153460251-153460273 CCCTCTGTGGAGCTGGAGCTGGG + Intronic
915146396 1:153798172-153798194 CTTCCCCAGGGGCAGGAGCTGGG + Intergenic
915308386 1:154994098-154994120 ACCTCTGGTGGGCAGGAGCTTGG + Exonic
915451252 1:156006957-156006979 CTCTTTCAGGGGCTGCAGCTTGG - Intronic
916485531 1:165255048-165255070 CTCTCTGTGGGGAAGGCTCTGGG + Intronic
916564469 1:165961438-165961460 CTCCATGAGGGGCAGGAACCAGG - Intergenic
917666015 1:177226612-177226634 GTCTCTGTGGGTCAGGAGCATGG + Intronic
918163174 1:181919934-181919956 ATCTCTGAGGGGCAGAGCCTAGG - Intergenic
919118057 1:193306102-193306124 CTCCAAGAGGGCCAGGAGCTTGG - Intergenic
919918538 1:202154054-202154076 CTTTCTGAGAGGTATGAGCTGGG + Intronic
920121820 1:203664624-203664646 AGCTGTGAGGGGCAGGAGCCTGG + Intronic
920673913 1:208025651-208025673 CTCTGTGAGTGTCAGGACCTTGG - Exonic
921172346 1:212560695-212560717 CAGCATGAGGGGCAGGAGCTGGG - Intergenic
922481952 1:225945264-225945286 CTCCCTTAGGTGGAGGAGCTGGG + Intergenic
922570714 1:226633321-226633343 CTGTCAGAGGTACAGGAGCTGGG - Exonic
922606727 1:226894234-226894256 CCCTCTGAGGGACAAGAGCAGGG + Intronic
922734824 1:227973321-227973343 TTTGCTGAGAGGCAGGAGCTGGG + Intergenic
922854806 1:228765770-228765792 CTCACTGAGGGGCAGAAACCAGG - Intergenic
922865007 1:228852315-228852337 GTCTTTGAGGGGGAGGAGCCTGG + Intergenic
922892905 1:229075237-229075259 CACTCTGAGGGGCTGGTGCTTGG + Intergenic
922979505 1:229813744-229813766 CTCTCTGAGAGGAAGGTGCTAGG - Intergenic
924172337 1:241356279-241356301 CTCTCTGATGGGCTGCAGGTGGG - Intronic
924180284 1:241434101-241434123 CTCTCTGGCGGGCAGGAGTTGGG - Intergenic
1066438507 10:35415496-35415518 CTCTCAGAGGAGATGGAGCTGGG + Intronic
1067438880 10:46297071-46297093 GTCTCTGGGTGGCAGGTGCTTGG + Intronic
1067575631 10:47406610-47406632 GTCTCTGGGTGGCAGGTGCTTGG + Intergenic
1067956512 10:50797049-50797071 GTTTCTGTGGGGCAGGAGCCAGG + Intronic
1067982180 10:51098974-51098996 CTCTCTGAGGCAAGGGAGCTAGG - Intronic
1068875118 10:61987387-61987409 TTCTTTGAAGGGCAGGAGCTAGG - Intronic
1069432993 10:68354056-68354078 CCCTTTGGGTGGCAGGAGCTAGG + Intronic
1069787505 10:70998141-70998163 CTCTCAGTGGGGCTGGGGCTGGG + Intergenic
1070279470 10:75038106-75038128 CACACTGAGGGGCAGGTGTTGGG + Intronic
1071506752 10:86237033-86237055 GTCTCTGAGGGGAAGGAGTGTGG - Intronic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1071842198 10:89484066-89484088 CTCTCTTAAGGCCAGGAGTTTGG + Intronic
1072151771 10:92689957-92689979 CTCTGCGAGGGGCCGGAGCGCGG + Exonic
1072512006 10:96136829-96136851 CTCTCTGAGGGTCAGATGCGAGG - Intronic
1072580073 10:96733237-96733259 TTCTCTGGGGGGCAGGGGCGGGG - Intergenic
1072580564 10:96736417-96736439 TTCTCTGGGGGGCAGGGGCGGGG - Intergenic
1073028472 10:100506069-100506091 CTCTGTGATGGGTAGGAGCTGGG - Exonic
1073132808 10:101201179-101201201 CTCTCTGGCGGGCAGGAGTGGGG + Intergenic
1073287254 10:102396392-102396414 CTCTCTCTGGGGGAGGGGCTGGG + Intronic
1074085660 10:110207734-110207756 CTCCCTGGGGGCCCGGAGCTCGG + Exonic
1074221645 10:111443952-111443974 CACTCTTAGAGGCAGGAGCTAGG + Intergenic
1074542800 10:114379352-114379374 ATCACTGTGGGGGAGGAGCTGGG - Intronic
1075008969 10:118851974-118851996 GTCCCTAAGGGGCAGGAGCCGGG - Intergenic
1076689359 10:132213412-132213434 CTCTCTGAGGAGGAGGATTTAGG + Intronic
1077019144 11:409806-409828 CAGCCTGAGGGGCAGGAGGTGGG + Intronic
1077331095 11:1984081-1984103 CTGCCTGAGGGCCGGGAGCTTGG + Intronic
1077376558 11:2207943-2207965 CCCTCTGAGGAGCAGGAGCAGGG + Intergenic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077701032 11:4442856-4442878 GTCTCTGAGGGACAAGAGTTAGG + Intergenic
1078105318 11:8354725-8354747 CTCCCTGAGGAGCAGCAGCTGGG + Intergenic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078830529 11:14973010-14973032 CTATCTGAGGCCCAGGCGCTGGG - Intronic
1078901354 11:15645388-15645410 CTTACAGAGGGGAAGGAGCTGGG + Intergenic
1079401943 11:20112833-20112855 CTTTCCAAGGGGAAGGAGCTGGG - Intronic
1079725056 11:23870253-23870275 CTCTCTGAAGGGGAGGCCCTGGG + Intergenic
1082261066 11:50076572-50076594 GCCACTGAGTGGCAGGAGCTGGG + Intergenic
1083412024 11:62500515-62500537 CTCTCTGAGGGACAGCACGTAGG - Intronic
1083783101 11:64928206-64928228 CTCTCTGAGGGGCCAGGGATAGG + Intronic
1084095332 11:66907573-66907595 CAAGCTGAGGGGCAGGAGGTAGG - Intronic
1084801242 11:71545616-71545638 TTCCCTGAGGGGAGGGAGCTGGG - Intronic
1085250755 11:75142121-75142143 CTCTCTGCTGAGCCGGAGCTGGG + Intronic
1086135718 11:83442358-83442380 TTCTCTGATGGGCAGGAGTGGGG + Intergenic
1087095474 11:94313646-94313668 CTATCTCAAGGGCTGGAGCTGGG - Intergenic
1087217529 11:95510028-95510050 GTCTCTGAGGAGCAGGACTTAGG - Intergenic
1088013068 11:105026606-105026628 GTCTCTGCAGGGCAGGAGCGGGG + Intronic
1088018747 11:105092820-105092842 GTCTCTGCAGGGCAGGAGGTGGG + Intronic
1089209603 11:116791349-116791371 CTCACTGAGGCGCGGGACCTGGG - Intronic
1089218691 11:116852498-116852520 CTTCCTGAGGAGCAGGAGCTCGG + Intronic
1089281482 11:117377639-117377661 CTCTCTCAAGGGCAGGACCAGGG + Intronic
1089540927 11:119188555-119188577 CGTGCTGAGGGGCAGGGGCTAGG + Intronic
1202814076 11_KI270721v1_random:39257-39279 CTGCCTGAGGGCCGGGAGCTTGG + Intergenic
1092189757 12:6510608-6510630 CACTGTGAGGGGCAGAATCTTGG - Exonic
1093005102 12:14043200-14043222 GTCTCTGAGTTGCAGGAGCCTGG + Intergenic
1094208985 12:27870589-27870611 CTCTCTGAAGTGCTGGAGCCCGG - Intergenic
1094427236 12:30328181-30328203 CTCTCCCAGGTGCAGGACCTGGG + Intergenic
1094811909 12:34146754-34146776 CTGTCTGAGGGTGGGGAGCTGGG + Intergenic
1095738109 12:45580054-45580076 CTATCTCAGGGGCAGCAGTTTGG + Intergenic
1096182431 12:49558098-49558120 CTCTCTGAGAGTCAGGAGCCAGG - Exonic
1096300792 12:50425661-50425683 CTCTCTAGGAGCCAGGAGCTGGG + Intronic
1096609510 12:52791635-52791657 ATTGCTGAGGGGCAGGGGCTAGG - Intronic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1098027743 12:66223018-66223040 TTCTCTGTGGGGCAGGAGTGGGG + Intronic
1098920449 12:76297582-76297604 CTCTCTTATGGGCAGGGGCGGGG - Intergenic
1099291636 12:80783290-80783312 TTCTCTGGCGGGCAGGAGTTGGG + Intergenic
1099294541 12:80813764-80813786 CGCTCAGAGGGGCAGGAGCCAGG - Intronic
1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG + Intergenic
1100939956 12:99715393-99715415 TTCTCTGGTGGGCAGGAGTTGGG - Intronic
1101581521 12:106046426-106046448 CTCTCTGTGGAGCCTGAGCTTGG + Intergenic
1102150760 12:110688086-110688108 CTCTCAGAGGGGCAGGACGGAGG + Exonic
1102664924 12:114563694-114563716 CACTCTGAGGTGCTGGAGTTTGG + Intergenic
1103950934 12:124550576-124550598 CTCTCTGGGGGGTAGGAACGTGG + Intronic
1104199443 12:126574220-126574242 GTTTCTGATGGGCAGAAGCTGGG + Intergenic
1104926086 12:132314621-132314643 CTCTCTAAGGTGCAGGAGAGGGG - Intronic
1104969041 12:132522924-132522946 CTCTAGGGGGGGCAGGGGCTTGG + Intronic
1105593917 13:21818182-21818204 CTCCCTGCGGGGCAGGGGCTGGG + Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106900164 13:34347381-34347403 CTCTCTGAGGAGCAGGGGATGGG + Intergenic
1108240017 13:48454532-48454554 CTCTATGAGGGGAAGGACCCAGG - Intronic
1108685446 13:52815393-52815415 CTCCCTGAGGGGCAGGGCTTAGG - Intergenic
1109583498 13:64370387-64370409 CTCTCTCAGTTGCTGGAGCTGGG + Intergenic
1112493054 13:99884351-99884373 CTCTCTCTGGGGCGTGAGCTGGG - Intronic
1113166376 13:107448101-107448123 CTGACTGAGAGGCAGGGGCTCGG - Intronic
1114454734 14:22847252-22847274 CTCAGTGAGGGGCAGGAGCTGGG + Exonic
1114668600 14:24397102-24397124 CTCCAGGAGAGGCAGGAGCTGGG + Intergenic
1115645760 14:35367525-35367547 CTCTTTGAGAGGCATGACCTCGG - Intergenic
1116148485 14:41106037-41106059 ATCTCAGAGAGGAAGGAGCTTGG - Intergenic
1116897326 14:50329649-50329671 CAATCTGAGAGGCAGGAGATAGG + Exonic
1116953128 14:50896681-50896703 CTCTCTGGTGGGCAGGGGCGGGG - Intronic
1121668680 14:95691782-95691804 CTCTCAGATGGGCAGCAGCTTGG + Intronic
1121703310 14:95973243-95973265 TTCTCTGGCGGGCAGGAGTTGGG - Intergenic
1122479020 14:102033766-102033788 ATCTCAGCGGGGCAGAAGCTGGG - Intronic
1122507352 14:102240123-102240145 TTCTCTGGCGGGCAGGGGCTAGG - Intronic
1123482361 15:20644081-20644103 CACACTGAGGAGCAGGTGCTGGG - Intergenic
1124037829 15:26072478-26072500 CTCTCTCAGGGGACAGAGCTAGG + Intergenic
1124046834 15:26158273-26158295 CTTTCTGAGTTGCAGGAGCAGGG + Intergenic
1124577767 15:30924853-30924875 CTTTGTGAGGGGCAGCTGCTGGG + Intronic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1125003585 15:34795373-34795395 GTCGCAGAGCGGCAGGAGCTGGG + Intronic
1128519625 15:68366801-68366823 TTCAATGAGGGGCAGGGGCTGGG - Intronic
1128563789 15:68685715-68685737 ATATCTGAGAGGCAGGAGCCAGG - Intronic
1128995306 15:72290400-72290422 TTCATTGAGGGGCAGGATCTGGG + Intronic
1129656175 15:77527023-77527045 CTGTCTCAGGGGCTCGAGCTGGG - Intergenic
1129822696 15:78615619-78615641 GTTTCTGTGGGGCAGGACCTGGG + Intronic
1130250077 15:82294342-82294364 TTCTCTGAGAGTCAGGAGGTTGG - Intergenic
1130414549 15:83680028-83680050 CTCTTTGCAGGGCAGGAGTTGGG + Intronic
1130939696 15:88497248-88497270 CCGTCTGAGAGGCAGCAGCTTGG + Intergenic
1130955274 15:88623032-88623054 CTCTGTGAGGGGCTGAGGCTAGG - Intronic
1131024889 15:89131976-89131998 ATCTCTCAGGGGCAGGAGTCAGG + Intronic
1131032252 15:89196055-89196077 CTCTCCGAGGGGAGGGACCTGGG - Exonic
1131448227 15:92517229-92517251 TTCTCTGACGGGCAGGAGTGGGG - Intergenic
1132138008 15:99363217-99363239 CTCTCTCAAGGGAAAGAGCTTGG - Exonic
1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG + Intronic
1132481846 16:170278-170300 CTTGCTGTGGGGCAGGGGCTGGG - Intergenic
1132752293 16:1464347-1464369 CTTTGGGAGGGGCAGGAGTTGGG - Intronic
1132994138 16:2814200-2814222 AGCTCTCAGAGGCAGGAGCTTGG + Intergenic
1133041740 16:3064692-3064714 CCTTCTGAGGGCCCGGAGCTGGG - Intergenic
1134064135 16:11216227-11216249 GTTTCTGAGGGGCAGGAATTTGG + Intergenic
1134237748 16:12480837-12480859 GTCTCTGCTGTGCAGGAGCTGGG + Intronic
1136230523 16:28882985-28883007 CTCTCAAAGGGGAAGGAGCGAGG + Intronic
1136248717 16:28989847-28989869 CTGCGGGAGGGGCAGGAGCTGGG + Intronic
1136261776 16:29082243-29082265 CACTCTGCGGCGCAGGAGCCGGG - Intergenic
1137683981 16:50373258-50373280 CTCACTCAGAGGCAGCAGCTGGG - Intergenic
1137768436 16:50995612-50995634 TTCTGTCAGAGGCAGGAGCTGGG + Intergenic
1138101639 16:54256617-54256639 CTCCCTGGGGGGCTGCAGCTCGG + Intronic
1138624097 16:58235717-58235739 CTCTCAGAGGAGGAGGTGCTGGG + Intronic
1138977209 16:62222002-62222024 CTCTCTCAGAGGCTGGGGCTGGG + Intergenic
1139582550 16:67881974-67881996 CTGGCTGAGGGGCAGCAGCGGGG + Exonic
1139776582 16:69320401-69320423 TGCCCTGAGGGGCTGGAGCTGGG - Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1139842651 16:69894011-69894033 CTCACTGAGTGACAGGAGCAAGG + Intronic
1139956714 16:70696790-70696812 TTCTCCCAGGGGCAGGAGCTGGG + Intronic
1140164022 16:72530179-72530201 TTCTCTGCGGAGGAGGAGCTCGG - Intergenic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1141294713 16:82756903-82756925 CTCTGTGAGGGCCAGGATTTGGG + Intronic
1141501994 16:84450709-84450731 ATCACCCAGGGGCAGGAGCTGGG + Intronic
1141526527 16:84615319-84615341 ATCCCTGGGGGGCAGGAGGTGGG + Intronic
1141608130 16:85167186-85167208 CCCTCTCAAGGGCAGGAGCTAGG - Intergenic
1142108675 16:88319548-88319570 CTCTCAGAGGGGAAGCAGCGGGG + Intergenic
1142202991 16:88770008-88770030 CTCTCTCAGGGGCAGAGGCGTGG - Intronic
1143658456 17:8310947-8310969 ATCCCTGAGGGGCAGGGGCTGGG + Intronic
1145937085 17:28720702-28720724 CTTTAGGAGGGGCAGGAGCTGGG - Exonic
1146410080 17:32575721-32575743 CTCTCTGATGGGCAGGATCCAGG - Intronic
1146791310 17:35752366-35752388 AGCTCTGGGGGGCAGGAGCCTGG - Intronic
1147163804 17:38582654-38582676 CTCTCTGAGGGGCGGTGGCAAGG + Intronic
1147177020 17:38662312-38662334 CTCTGTGGAGGGCAGGTGCTGGG - Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147897395 17:43759512-43759534 ATCCCTGAGGAGCATGAGCTGGG - Intergenic
1148073177 17:44920596-44920618 TTGGCGGAGGGGCAGGAGCTGGG + Intergenic
1150287325 17:63961671-63961693 CTCACTGAGGCGGTGGAGCTTGG - Intronic
1150287389 17:63961884-63961906 CTCTGTGAGGCGGAGGAGCTTGG - Intronic
1150867423 17:68868149-68868171 CTCTCCAAGGAGCAGGAGCTGGG - Exonic
1150876431 17:68975979-68976001 CTCTCCAAGGAGCAGGAGCTGGG - Exonic
1150890929 17:69148891-69148913 CTCTGTAAAGAGCAGGAGCTGGG - Exonic
1151567438 17:74907172-74907194 CTCCCTGAGGGGCAGGGCCCGGG - Intergenic
1151859915 17:76752762-76752784 CTCTCAGCAGGGCAGGAGATAGG + Intronic
1152430090 17:80244036-80244058 CTCTCTCAGGGCCGTGAGCTGGG + Intronic
1152581040 17:81165761-81165783 ATCTCGGAGGGGCAGGCCCTGGG - Intronic
1155183168 18:23365796-23365818 CTCTCTGAGGAGCTGGATTTAGG - Intronic
1155384379 18:25261251-25261273 CTGTCTGATTAGCAGGAGCTAGG + Intronic
1155943959 18:31826850-31826872 CTCTCTGGCAGGCAGGAGCAGGG + Intergenic
1156014566 18:32533376-32533398 CTCTCTGGCGGGCAGGGGCGGGG + Intergenic
1157188775 18:45562789-45562811 CTCCCTGGGGGGAAGGGGCTGGG + Intronic
1158164461 18:54524000-54524022 GACTCTCAGGGGCAGGATCTGGG - Intergenic
1160226148 18:77012638-77012660 CACACAGAAGGGCAGGAGCTCGG + Intronic
1160327719 18:77966423-77966445 TCCTCTGAGGGACAGGAGCCTGG + Intergenic
1160918328 19:1508143-1508165 CGCTGGGAGGGGCAGGACCTGGG + Intronic
1161178503 19:2863439-2863461 ATCTCTGAGGGGCAGATACTAGG - Intergenic
1161469438 19:4448975-4448997 CTCGGGGAGGGGCAGGGGCTGGG - Intronic
1161745607 19:6057873-6057895 CCCTCTGAGGGCCAGGTCCTCGG + Intronic
1162044738 19:7991076-7991098 CTCTCAGAGGGGCAGGAGCCTGG - Intronic
1162458172 19:10798336-10798358 CTCACTGGGGGCCAGGAGCAAGG + Intronic
1163343812 19:16727225-16727247 CGCTCTGAGGACGAGGAGCTGGG + Intronic
1163369311 19:16893233-16893255 GTCTCTGAGGGGCCGGAGTCTGG + Exonic
1164650549 19:29887971-29887993 TTGTCTGTGGGGCAGGAGCCAGG - Intergenic
1165907941 19:39204950-39204972 CTCCCTGGGAGGCAGGACCTTGG + Intergenic
1166105579 19:40596673-40596695 CCCTCAGAGGGGCAGGACCTGGG + Intronic
1166315715 19:41988374-41988396 CTGTCTGAGGAACAGGAGTTTGG + Exonic
1167053324 19:47093550-47093572 CTCTCTGAAGTAAAGGAGCTGGG - Intronic
1167676906 19:50892922-50892944 CTATCTGAGAGGCAGGAGTAGGG + Intergenic
1168168258 19:54569904-54569926 CTCTCTGGGGGCCAAGAGGTAGG - Intergenic
1168307119 19:55441920-55441942 CCTTCTGTGGGCCAGGAGCTGGG - Intronic
925664410 2:6238041-6238063 CCCACTGTGGGGCAGGAGGTGGG - Intergenic
926820272 2:16844220-16844242 CTCTCTGAGTGGCATGAGTTTGG - Intergenic
927042151 2:19240513-19240535 CTCTCTGAGGGCAGGGAGCAGGG + Intergenic
927199708 2:20570790-20570812 CTCTCTGAGCTGGAGGAGTTTGG + Intronic
927501062 2:23583555-23583577 CTCTCAGAAGGGAAGGAGCTGGG + Intronic
927862756 2:26570527-26570549 CTCTCAGTGAGGCAGGTGCTAGG + Intronic
928235051 2:29531959-29531981 CTCGTTGTGGGGCAGCAGCTGGG + Exonic
929537517 2:42792792-42792814 TTCTCCGCGGGGCAGGGGCTCGG + Intergenic
929567987 2:43001694-43001716 CTCTCTGAGGGGCAGGCACTGGG - Intergenic
930046561 2:47177419-47177441 CTCTCTCAGGTGCAAGACCTTGG + Intergenic
930216337 2:48701125-48701147 GGGGCTGAGGGGCAGGAGCTAGG + Intronic
931239235 2:60437791-60437813 CTCTCAGATGGGCAGAAGATTGG - Intergenic
932790942 2:74654220-74654242 CTTTCTGAGGGGGCGGAGCCGGG + Exonic
933725057 2:85421951-85421973 CTCTCTTGGGGGCAGAATCTGGG + Intronic
933764121 2:85695505-85695527 CTCTCTAATGGTCAGGAGGTGGG + Intronic
934475002 2:94587828-94587850 CCTCCTGAGGGGCTGGAGCTGGG + Intergenic
934563098 2:95323281-95323303 CCCTCTGGGGTGCAGGAGGTTGG + Intronic
935607196 2:104983045-104983067 CTCCCTGAATGGCAGGAGATCGG - Intergenic
936244807 2:110817294-110817316 CTCTGTGAGGGGAGGCAGCTTGG + Intronic
937279859 2:120710365-120710387 CTCCCAGAGGGGCCGGAGGTGGG - Intergenic
938082085 2:128375570-128375592 CTCTCTGGGGGCCAGGACCTGGG + Intergenic
938139117 2:128782178-128782200 CCCTCTGAGGCAGAGGAGCTGGG + Intergenic
938548966 2:132361806-132361828 GGCTCTGAGGGGCACGAGCCAGG - Intergenic
938839109 2:135140987-135141009 CTTTCTGAAGGGTAGGAGGTAGG + Intronic
942456216 2:176140318-176140340 GGCTCTGGGGGGCAGCAGCTCGG + Intergenic
942595580 2:177589029-177589051 CCCTCTGAGGGGCCAGGGCTGGG + Intergenic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
945907692 2:215613569-215613591 CCCTCTGAGGTGCAGAAACTCGG - Intergenic
946780419 2:223188940-223188962 TTCTCTGAAGGGCAGGAGTGGGG + Intronic
948270462 2:236669751-236669773 GTCTCTGATGGGGAGAAGCTGGG - Intergenic
948336658 2:237213757-237213779 CTCTGTGAGGTTCAGGACCTTGG + Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
1169915025 20:10674904-10674926 CTCTCTGGGTGGCAAGAGATGGG + Intergenic
1170398652 20:15956434-15956456 CTCTCTGAGTGACAGAATCTGGG - Intronic
1171490916 20:25516623-25516645 CTCCCTAAGGCACAGGAGCTTGG - Intronic
1172648224 20:36484692-36484714 CTCTCGGAAAGGCAGGAGCCTGG - Intronic
1173898148 20:46566430-46566452 CTCTCTGGGGGGCGGCAGCTGGG - Intronic
1174149757 20:48477831-48477853 GTCTTTGAGGGGCAGGAACTAGG - Intergenic
1175077876 20:56391505-56391527 ATCTCTGAGGGGTAGGACCCAGG - Intronic
1175550474 20:59814128-59814150 CTCCCTGGGGGTCAGGAGCGAGG + Intronic
1176074467 20:63242171-63242193 GTCTCTCTGTGGCAGGAGCTGGG - Intronic
1176120747 20:63453519-63453541 CTCTCAGCGGGGTAGGAGCAGGG + Intronic
1177119219 21:17121693-17121715 TTCTCTGATGGGCAGGAGTGGGG - Intergenic
1179583602 21:42360876-42360898 CTCACTGTGGAGCAGAAGCTGGG - Intergenic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180172628 21:46067707-46067729 CCCACTGAGGTGGAGGAGCTGGG + Intergenic
1181123752 22:20690038-20690060 CTCTGTGGGGCCCAGGAGCTGGG + Intergenic
1181621398 22:24093966-24093988 CTATCTCAGGAGCAGCAGCTTGG + Intronic
1181983544 22:26783291-26783313 CTCTAGGAGAGGCAGAAGCTGGG + Intergenic
1182074777 22:27488139-27488161 CCCTCTGAGTGGCAGGGCCTGGG + Intergenic
1182607788 22:31520231-31520253 CTCTCTGAGGGGCAGTCAGTGGG - Intronic
1183466584 22:37983265-37983287 CGCTCTGAGGTGCAGGAGGCCGG + Intronic
1183775893 22:39965005-39965027 CTCACAGAGGTGCAGGGGCTTGG - Intronic
1184453848 22:44598154-44598176 CTCACTGAGGGGTAGGGGCTGGG - Intergenic
1184620769 22:45674512-45674534 CTCTCAGAGGAGCAGGAGTCTGG - Intronic
1185242762 22:49755355-49755377 GTCGGTGGGGGGCAGGAGCTGGG - Intergenic
1185281655 22:49972341-49972363 CTGCCTGAGGGGCAGGAACCTGG - Intergenic
949770520 3:7572280-7572302 ATCTCTGAGGGGCAAGAAATAGG - Intronic
950444301 3:13027326-13027348 CTCACTTCAGGGCAGGAGCTGGG + Intronic
950471061 3:13186736-13186758 CTCCCTGAGGCACAGGGGCTGGG + Intergenic
950680224 3:14580110-14580132 GTCCCTGTGGGGCAGGGGCTGGG + Intergenic
952343063 3:32461113-32461135 TTCTCTGATGGGCAGGAGTGGGG + Intronic
954326528 3:49867097-49867119 CTCTCTCAAGGGCTGGGGCTGGG + Intronic
954386773 3:50248278-50248300 CCCTCTGAGAGGCAGGTGCGAGG + Intronic
954746818 3:52792109-52792131 CCATCTGAGGGGCAGCATCTTGG - Intergenic
955480449 3:59384567-59384589 CTCTATGCGTGGCATGAGCTAGG - Intergenic
956784629 3:72632301-72632323 CTCACTGTGGGCCAGGTGCTGGG - Intergenic
956979758 3:74622177-74622199 ATCTCTGAGGGGCAGTACCCAGG + Intergenic
957074413 3:75590507-75590529 CTCTCTGAAGGGGAGGCGGTGGG - Intergenic
957302930 3:78416428-78416450 CTCTGTATGGGGCAGGAGATAGG - Intergenic
958045381 3:88278426-88278448 CTCTCTAAGAGGCAGGACTTTGG - Intergenic
958615855 3:96493247-96493269 ATCTCTGAGGGGCTGGTACTGGG + Intergenic
961165884 3:124763593-124763615 TTCTCCGAGGGGCTGGAGCGGGG - Exonic
961831786 3:129626861-129626883 CTCTCTGCGGGGCGGGAGCACGG - Intergenic
962437808 3:135382809-135382831 GCCTCTGAGAGGCAGGAGCAGGG - Intergenic
962708148 3:138064355-138064377 CTCTCCGAGAGGCAGGAGATGGG + Intronic
963520169 3:146354026-146354048 TTCTCTGATGGGCAGGAGTGGGG - Intergenic
964068344 3:152602955-152602977 TTCTCTGGCGGGCAGGAGTTGGG - Intergenic
966327182 3:178770219-178770241 CTCTCTCAGAGCCTGGAGCTTGG - Intronic
966961108 3:184939879-184939901 CCCTCGGAGTGGCAGGTGCTTGG - Intronic
968705135 4:2074146-2074168 CTCTCTGAGCAGCAGTTGCTTGG - Intronic
969464260 4:7345447-7345469 CTCAGTGAGGGGCAGTAACTTGG + Intronic
970323760 4:14901630-14901652 CTGTCTGTGGGGCAGGGGTTGGG + Intergenic
970932958 4:21534832-21534854 CTCCATGAGGGGCAGAAGTTTGG + Intronic
975648506 4:76568787-76568809 CTCCCTGAGGGGTAGGAGGTGGG - Intronic
977322240 4:95532206-95532228 ATCTCTGAGGGTGAGGAGATTGG + Intronic
978311528 4:107389121-107389143 CTTTCTATGGGGCAGGAGTTGGG - Intergenic
978795745 4:112705993-112706015 CACTCTGCGGCGCAGGAGCCGGG + Intergenic
980774520 4:137421251-137421273 CTCCCCGCGGGGCAGGGGCTCGG + Intergenic
980823419 4:138045129-138045151 CTTTATGCAGGGCAGGAGCTGGG - Intergenic
982324822 4:154119496-154119518 CCCTCTGAGGAGCAGGAGAAGGG - Intergenic
982385768 4:154800273-154800295 CTTTTTGAGGGGCAGGGGATAGG + Intronic
984612073 4:181852346-181852368 CCCCCTGAGTGGCAGGTGCTGGG + Intergenic
984710527 4:182880511-182880533 CTCTCGGAGGAGCAGCAGCAGGG - Intergenic
985288103 4:188357569-188357591 CTCCCTGATGGGCAGGAACTTGG + Intergenic
985389418 4:189479713-189479735 TTCTCTGGTGGGCAGGAGTTGGG + Intergenic
985489542 5:171334-171356 CTGGCCCAGGGGCAGGAGCTGGG + Exonic
986636466 5:9827040-9827062 ATTTCTGAGGCTCAGGAGCTGGG - Intergenic
986783881 5:11092553-11092575 CACTCTGTGGAGCAGGAGATGGG - Intronic
988291739 5:29296618-29296640 CTCCCTGAGGGGCAGGGCTTGGG - Intergenic
990661703 5:58022692-58022714 CTTTCTGAGGGAAAGGAGATAGG - Intergenic
991468141 5:66936536-66936558 TTCTCTGACGGGCAGGAGTACGG + Intronic
992998127 5:82352498-82352520 CTTACTGAGGGGCAGGAAGTTGG - Intronic
993331188 5:86602534-86602556 CTCTCAGAGGGCCAGGGGTTAGG - Intergenic
993363734 5:87009504-87009526 TTCTCTGAGAGGAAGGAGCAAGG + Intergenic
994990008 5:106983886-106983908 TTCTCTGGGGGGCAGGAGTGGGG - Intergenic
995092046 5:108189484-108189506 TTCTCTCAGGGTCAGGAGGTGGG - Intronic
995883440 5:116867610-116867632 TTCTCTGGTGGGCAGGAGTTGGG + Intergenic
996064768 5:119068591-119068613 ATCTGTGAGGGGCAGCATCTTGG + Intronic
996389711 5:122946870-122946892 CACTGTGCAGGGCAGGAGCTGGG + Intronic
996541493 5:124634069-124634091 CTACCTGTGGGGCAGGGGCTAGG + Intergenic
996966806 5:129316152-129316174 CCCTCTGAAGGGAAGGAACTAGG + Intergenic
997770024 5:136545145-136545167 TTCTCTGGTGGGCAGGGGCTGGG + Intergenic
998950786 5:147391394-147391416 CTCTCTGAGGGCCACGGGCTTGG - Exonic
1000439364 5:161248617-161248639 TTCTCTGATGGGCAGGGGTTGGG - Intergenic
1000440266 5:161254818-161254840 TTCTCTGACGGGCAGGAGTGGGG - Intergenic
1000722618 5:164727294-164727316 CTCTCAGACGGAAAGGAGCTAGG + Intergenic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1002066490 5:176654579-176654601 CTACCTGAGAGGCAGGCGCTGGG - Intronic
1002157457 5:177294383-177294405 CTGACTGAGGGTGAGGAGCTTGG - Exonic
1002321344 5:178377819-178377841 CTGTGTGTGTGGCAGGAGCTGGG + Intronic
1002783905 6:386854-386876 CTCTCAGACGGGCAGGTGCATGG - Intergenic
1002858247 6:1056777-1056799 CTCCCGGAGGGGCCGGAGCCAGG - Intergenic
1002993030 6:2255546-2255568 GTTTCTGTGGGGCAGGAGCCTGG + Intergenic
1003648133 6:7932858-7932880 CTCTAGGAGGGACAGGAGCAAGG + Intronic
1003740862 6:8937530-8937552 CTGTCAGAGGGTCAGGGGCTGGG - Intergenic
1003858686 6:10301679-10301701 ATTTTTGAGGGGCAGGAGGTGGG - Intergenic
1004179648 6:13370131-13370153 CTCTCTGGGGCTCAGGAACTGGG - Intronic
1006220316 6:32484294-32484316 CTTCCTGAGGCGCAGGAACTGGG - Intergenic
1006348496 6:33502922-33502944 CTCCCTGAGGGGCAGGGTTTGGG + Intergenic
1006612223 6:35301019-35301041 CTCCTTGACTGGCAGGAGCTGGG + Intronic
1006737736 6:36286607-36286629 CTCTCTGAGTGGCTGAAACTTGG + Intronic
1006795722 6:36731216-36731238 GTCTCTGAGTGGCTGGAACTTGG - Intronic
1006823776 6:36918657-36918679 TTCTCTGAAGGGCAAGAGATAGG + Intronic
1006897056 6:37477955-37477977 CTCTCTCAGCAGCGGGAGCTGGG - Intronic
1007182752 6:39942219-39942241 GTTTCTAAGGGGCAGGAGCCTGG - Intergenic
1007585137 6:42984754-42984776 CTCTGGGAGGGGCCGGAGCCAGG + Intronic
1007725176 6:43911686-43911708 CTAGCTGAGGAGCCGGAGCTGGG - Intergenic
1007839841 6:44706801-44706823 GTCACTGGTGGGCAGGAGCTGGG - Intergenic
1008540046 6:52538426-52538448 CTCTCCTCAGGGCAGGAGCTGGG + Intronic
1011554670 6:88562199-88562221 CTCTCTGAGGGCCTAGAGATTGG + Intergenic
1012131322 6:95497215-95497237 CCCACTGCGGGGCAGGGGCTTGG - Intergenic
1012689182 6:102292959-102292981 TTCTCTGGGGGGCAGGGGCGGGG - Intergenic
1015390990 6:132681452-132681474 ATTTCTGAGGGTCAGGATCTGGG - Intergenic
1016343855 6:143089794-143089816 CTCTCTGGGGGGCAGTAAATGGG - Intronic
1017862565 6:158412771-158412793 CCATCTGAGAGGCAGGTGCTGGG + Intronic
1017963273 6:159240679-159240701 CTCCCTGAAGAGCAGGAGCTAGG + Intronic
1019048208 6:169163767-169163789 CCCACTGAGAGGCAGGAACTGGG + Intergenic
1019206561 6:170366463-170366485 TGCTCTGAGGGGCAGGTGCCAGG + Intronic
1019624596 7:2009559-2009581 CTCACCCAGGGGCAGGTGCTGGG - Intronic
1019833602 7:3358475-3358497 CTCTGCGAGGAGCAGTAGCTGGG - Intronic
1021804123 7:24338407-24338429 GTCTCTGGGGGGCAGGTTCTTGG + Intergenic
1022282526 7:28925529-28925551 CCCTCTGAGGGTGGGGAGCTTGG + Intergenic
1022422221 7:30234193-30234215 CTCCCAGAGAGGCAGGAGCCTGG - Intergenic
1023401148 7:39793572-39793594 CTTGCTGGGAGGCAGGAGCTGGG + Intergenic
1024074653 7:45812303-45812325 CTTGCTGGGAGGCAGGAGCTGGG + Intergenic
1024648465 7:51387109-51387131 CTTGCTGGGAGGCAGGAGCTGGG - Intergenic
1024666042 7:51548236-51548258 CTCTCAGAAGGGCTGGAGCTGGG - Intergenic
1025052314 7:55741578-55741600 CTTGCTGGGAGGCAGGAGCTGGG - Intergenic
1025052708 7:55743126-55743148 CTTGCTGGGAGGCAGGAGCTGGG - Intergenic
1025176363 7:56804314-56804336 CTTGCTGGGAGGCAGGAGCTGGG - Intergenic
1025641203 7:63371613-63371635 CTATCTGAGGAGGAGCAGCTGGG - Intergenic
1025689265 7:63745537-63745559 GACTGTCAGGGGCAGGAGCTGGG - Intergenic
1025695431 7:63772108-63772130 CTTGCTGGGAGGCAGGAGCTGGG + Intergenic
1025912509 7:65839849-65839871 GTCTGTCAGGGGCAGGAACTGGG - Intergenic
1025968376 7:66297350-66297372 TTCCCTGAGAGGCAGAAGCTAGG + Intronic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1026944324 7:74306400-74306422 CTCCCGGAGGGGCAGGTGCTTGG - Intronic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1028590192 7:92485021-92485043 TTCTCTTAGGGGCAGGGGCGGGG + Intergenic
1028674087 7:93438621-93438643 CTCTCTTATGGAGAGGAGCTGGG + Intronic
1028992906 7:97069110-97069132 CTCTCTGATGGAGAGGAGCAAGG - Intergenic
1029657605 7:101937225-101937247 CTTTCACAGGGGGAGGAGCTGGG - Intronic
1031171607 7:118298874-118298896 GTCTCTGAGGGGCAGGAACCTGG + Intergenic
1031422791 7:121569435-121569457 TTCTCTGGCGGGCAGGAGTTGGG + Intergenic
1031945102 7:127831339-127831361 CTCTCTGAAGGGCTGCAGCTAGG + Intronic
1032097627 7:128947436-128947458 CTCTCTGAGGTCCTGGAGCCTGG + Exonic
1032215059 7:129951699-129951721 CTCTGTGAGGGTCAGGTTCTTGG - Intronic
1032692589 7:134303907-134303929 CTCTCTTTGGGACAGGAGCAGGG - Intronic
1033157908 7:138972151-138972173 CTCACTGAGGGGCTGGTGCCTGG + Intronic
1033289422 7:140070453-140070475 CTTTCAGAGGGGCAGGTCCTTGG - Intergenic
1034275371 7:149821620-149821642 CCCTCCGGGGTGCAGGAGCTGGG - Intergenic
1034540465 7:151754948-151754970 CTCTCTGAGAGGCAGGCTCTGGG + Intronic
1034673905 7:152877953-152877975 CTTTCTGAGGTGGAGGAGGTTGG + Intergenic
1035010836 7:155713882-155713904 CTTGCTGAGGGGGAGGAGCAGGG + Intronic
1035565119 8:636059-636081 CTCTCAGAGAGGCAAAAGCTGGG + Intronic
1036212781 8:6855576-6855598 CACTCTGAGTGGCTGGAGTTAGG + Intergenic
1036339533 8:7903597-7903619 TTCTCTGGGGGGCAGGAGTGGGG + Intergenic
1038493687 8:27987198-27987220 CTCTCTCAGGAGCAGAAGCATGG + Intronic
1039406557 8:37318327-37318349 CCCCCTGAGGAGCAGGAGCCAGG + Intergenic
1040079868 8:43275277-43275299 CTGTCTGAAGGCCAGGAGGTAGG + Intergenic
1040895680 8:52366108-52366130 CGCTGTGAGGGGGAGGAGGTAGG + Intronic
1043599447 8:81919690-81919712 TTCTCTGGTGGGCAGGGGCTAGG - Intergenic
1043857640 8:85279609-85279631 CTACCAGAGGGGCAGGAGCTAGG + Intronic
1046507930 8:115160056-115160078 CTCTCAGAGCTGCAGAAGCTAGG + Intergenic
1046770611 8:118112896-118112918 CACTGGGAGTGGCAGGAGCTTGG - Intergenic
1047689946 8:127341586-127341608 CTCTCAGATGAGAAGGAGCTTGG - Intergenic
1047692446 8:127370215-127370237 CTCTCTGAGGGACAGGACCCAGG + Intergenic
1047856868 8:128920121-128920143 TTCTCTGGCGGGCAGGAGTTGGG - Intergenic
1048512898 8:135078544-135078566 TTCTTTGTGGGGCAGGAGATTGG - Intergenic
1048575557 8:135687157-135687179 CTCACTCAGGGGCAGGGGCAGGG - Intergenic
1048976228 8:139674498-139674520 CTCTGTGAGGGGCAGGGACCCGG + Intronic
1049402584 8:142436178-142436200 CCCTCTAAGAGGCAGGTGCTGGG - Intergenic
1049854947 8:144855659-144855681 CTTTCTGGGGGGCAGGTGCAGGG + Intergenic
1049986951 9:960662-960684 CTGGCTGAGGGGTACGAGCTGGG + Intronic
1050182106 9:2933525-2933547 CTTCCTGAGGCGCAGGAACTTGG - Intergenic
1052855049 9:33401932-33401954 CCTCCTGAGGGGCTGGAGCTGGG - Intronic
1053411204 9:37917277-37917299 CCCTGAGAGGGGCAGGAGGTTGG + Intronic
1053683067 9:40498273-40498295 CCTCCTGAGGGGCTGGAGCTGGG - Intergenic
1053751931 9:41266104-41266126 GGCTCTGAGGGGCACGAGCCAGG + Intergenic
1053933050 9:43126589-43126611 CCTCCTGAGGGGCTGGAGCTGGG - Intergenic
1054257454 9:62830434-62830456 GGCTCTGAGGGGCACGAGCCAGG + Intergenic
1054280647 9:63126655-63126677 CCTCCTGAGGGGCTGGAGCTGGG + Intergenic
1054296167 9:63333771-63333793 CCTCCTGAGGGGCTGGAGCTGGG - Intergenic
1054394183 9:64638276-64638298 CCTCCTGAGGGGCTGGAGCTGGG - Intergenic
1054428833 9:65143475-65143497 CCTCCTGAGGGGCTGGAGCTGGG - Intergenic
1054501546 9:65878060-65878082 CCTCCTGAGGGGCTGGAGCTGGG + Intronic
1055347175 9:75351323-75351345 TTCTCTGGTGGGCAGGAGCGGGG + Intergenic
1055816988 9:80218430-80218452 CAGTCTGTGGGCCAGGAGCTGGG - Intergenic
1056522049 9:87410946-87410968 TTCTCTGGCGGGCAGGAGTTGGG - Intergenic
1056757586 9:89391619-89391641 CTCTCTGAGGCCGAGGAGGTGGG - Intronic
1057146989 9:92764985-92765007 CTCTGTGAGGGGCGGGCCCTCGG + Intergenic
1057571785 9:96209522-96209544 CTTTCTGAGGGTCAGGAGTTTGG - Intergenic
1057786909 9:98094628-98094650 CAATCTGAGGGGCAGAAGCAGGG + Intronic
1058547322 9:106074365-106074387 TTCTCTGGGGGGCAGGCCCTTGG + Intergenic
1059412274 9:114139809-114139831 CTCTCAGGATGGCAGGAGCTGGG + Intergenic
1060536763 9:124395928-124395950 CTCTCCGTGGGCCAGGGGCTGGG - Intronic
1061047823 9:128176656-128176678 CTCTGGGAGGGGCAGAAGCTCGG - Intronic
1061488925 9:130934504-130934526 CTCCCGGAGGGGCAGAGGCTGGG - Intronic
1061807706 9:133145650-133145672 CTCTCTGAGCCTCAGGGGCTGGG - Intronic
1061921366 9:133784253-133784275 CTCTCTCAGGGGCCTGGGCTGGG + Intronic
1061949146 9:133926514-133926536 GACTGGGAGGGGCAGGAGCTAGG - Intronic
1062244219 9:135555657-135555679 ATTTCTGAGGGTCAGGAGGTGGG - Intergenic
1062265914 9:135686404-135686426 CTTTCTGAGGAGCAGGAGCTGGG - Intergenic
1062354535 9:136155526-136155548 CAGTTTGAGGAGCAGGAGCTGGG - Intergenic
1186749697 X:12608796-12608818 CTCTATGAGGGCAAGGAACTTGG - Intronic
1187139601 X:16580226-16580248 CTCTCTGGCGGGCAGGGGCAGGG + Intergenic
1187246511 X:17557604-17557626 GTCTCTGTGGGCCAGGAGTTTGG + Intronic
1187961512 X:24570619-24570641 GTCTCTGAGGGTCAGGAACCAGG - Intronic
1188068999 X:25695970-25695992 ATCTCTGAGGGCTAGGGGCTGGG - Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1192088977 X:68132796-68132818 CCCACTGAGGAGCCGGAGCTTGG + Intronic
1192341464 X:70267130-70267152 CTCAGTGAGGGGCAGGAGTTAGG + Intergenic
1193490598 X:82144008-82144030 CCCTCTGGAGGGCAGCAGCTAGG - Intergenic
1194186604 X:90778885-90778907 TTCTCTGAAGGGCAGGAGTGGGG + Intergenic
1194380187 X:93181446-93181468 CGCTCTGTGGGGCAGGAGGCCGG - Intergenic
1195460251 X:105115883-105115905 CTCTCTGCGGGGCAGGGCTTGGG - Intronic
1195936993 X:110134939-110134961 CTCTCTGGGGAGTAGGAGGTGGG - Intronic
1196299696 X:114040303-114040325 TTCTCTGATGGGCAGGAGTGGGG - Intergenic
1196862293 X:120039720-120039742 TTCTCTGAGGAGGAGGAGCAAGG - Intergenic
1196880809 X:120196624-120196646 TTCTCTGAGGAGGAGGAGCAAGG + Intergenic
1197692143 X:129513722-129513744 AGCTCAGAGGGGGAGGAGCTTGG - Intronic
1198984020 X:142428727-142428749 TTCTCTGGCGGGCAGGAGGTGGG + Intergenic
1199094823 X:143726368-143726390 CTCCCTGCGGGGCAGGACTTGGG - Intergenic
1199777808 X:151030966-151030988 CTCTCTGAGGAGGAGGAAGTGGG + Intergenic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic
1201430529 Y:13897424-13897446 CTCTCTGTGGGGCAGGGCTTGGG + Intergenic
1201580780 Y:15510247-15510269 TTCTCTGGGGGGCAGGAGTGGGG + Intergenic
1201798104 Y:17923828-17923850 CTCACTGAGAAGCAGCAGCTGGG + Intergenic
1201803449 Y:17982129-17982151 CTCACTGAGAAGCAGCAGCTGGG - Intergenic
1202359429 Y:24092519-24092541 CTCACTGAGAAGCAGCAGCTGGG + Intergenic
1202511349 Y:25577595-25577617 CTCACTGAGAAGCAGCAGCTGGG - Intergenic