ID: 1132464287

View in Genome Browser
Species Human (GRCh38)
Location 16:70672-70694
Sequence CCTGGGACCTTAGGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132464287_1132464299 19 Left 1132464287 16:70672-70694 CCATCACTGCCTAAGGTCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1132464299 16:70714-70736 GCCTTGGGCCAGGTCTGCCCAGG 0: 1
1: 1
2: 3
3: 38
4: 306
1132464287_1132464297 4 Left 1132464287 16:70672-70694 CCATCACTGCCTAAGGTCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1132464297 16:70699-70721 ATAAGGGAGCTCAAAGCCTTGGG 0: 1
1: 1
2: 1
3: 9
4: 150
1132464287_1132464296 3 Left 1132464287 16:70672-70694 CCATCACTGCCTAAGGTCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1132464296 16:70698-70720 TATAAGGGAGCTCAAAGCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 123
1132464287_1132464302 30 Left 1132464287 16:70672-70694 CCATCACTGCCTAAGGTCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1132464302 16:70725-70747 GGTCTGCCCAGGAGCTGCAGTGG 0: 1
1: 1
2: 0
3: 36
4: 339
1132464287_1132464298 9 Left 1132464287 16:70672-70694 CCATCACTGCCTAAGGTCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1132464298 16:70704-70726 GGAGCTCAAAGCCTTGGGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132464287 Original CRISPR CCTGGGACCTTAGGCAGTGA TGG (reversed) Intronic
900709117 1:4101322-4101344 CATTGGACATCAGGCAGTGAAGG - Intergenic
901387922 1:8923313-8923335 CCTGGGCTCTGATGCAGTGATGG - Intergenic
903044625 1:20555342-20555364 TCTGGGACATTTGGCAGGGAGGG + Intergenic
903847971 1:26289773-26289795 CCTGGGCACTTGTGCAGTGAGGG - Intronic
904976724 1:34462180-34462202 CCTGGGATCTTTGGGAGAGATGG + Intergenic
906678264 1:47708717-47708739 CCAGGGGCCTTAGGCGGAGATGG - Intergenic
907321475 1:53605437-53605459 CCGGGGAGCTCAGGCAGTGGAGG - Intronic
907337930 1:53712641-53712663 CCTGTGACCTTATTCAGTTAGGG - Intronic
907365087 1:53951822-53951844 CCTGGGAACTTTGGCATTCAAGG - Intronic
909347981 1:74614969-74614991 ACTGGGAACTTAGGAAGTTATGG - Intronic
913535277 1:119766325-119766347 CCTGGCACCCAGGGCAGTGAAGG - Intronic
917930409 1:179818781-179818803 CCTTGAACCTCAGGCACTGACGG + Intergenic
918781755 1:188708449-188708471 CTTGTTACCTTAGACAGTGATGG - Intergenic
921086719 1:211800877-211800899 CCTGGGAGCTTAGTGGGTGAAGG - Intronic
924858788 1:247900160-247900182 CGTGTGACCTTAGGAATTGACGG - Intergenic
1062825400 10:564407-564429 CTTTGGACGTCAGGCAGTGAAGG - Intronic
1065856183 10:29832165-29832187 CCTGGGCCCTGGGGAAGTGAAGG - Intergenic
1067673377 10:48346847-48346869 CCTGGCAGCTGAGGCAGAGAGGG - Intronic
1069570468 10:69491710-69491732 CCTGAGACCTGAGGCTGGGAAGG - Intronic
1069885246 10:71619578-71619600 CCAGTGACCACAGGCAGTGAGGG + Intronic
1070746549 10:78937184-78937206 CCTGGGACCTGAGTCAGGCAAGG + Intergenic
1074065489 10:110008664-110008686 CCGGGGACCTTAAGCCCTGAAGG + Intronic
1074277251 10:112015238-112015260 CCTGGGACCTGAGGCCCTGTAGG - Intergenic
1077412749 11:2411100-2411122 CCTGGGGCCTTGGGCTGGGAAGG - Intronic
1080399187 11:31918267-31918289 CCATGGACCTTAGGAAATGAAGG - Intronic
1083956660 11:65987607-65987629 CCTGGGACCCAAGGCAGAGCAGG - Intergenic
1084654212 11:70505795-70505817 CCTGGCCACTTAGGCAGGGAGGG + Intronic
1089617813 11:119704848-119704870 CCTGGGACCTTGGGCAGCAAGGG + Intronic
1089855934 11:121544843-121544865 CCTGCTTCCTCAGGCAGTGAGGG - Intronic
1091286297 11:134410466-134410488 TCTGGAACCTTTGGCAGTGCTGG + Intronic
1091438577 12:494755-494777 CCAGGCTCCTGAGGCAGTGATGG + Intronic
1092748717 12:11698143-11698165 CCTGGAACCTGTGGCAGGGAAGG - Intronic
1094405302 12:30110488-30110510 CCTCAGCCCTTGGGCAGTGATGG + Intergenic
1095699291 12:45174749-45174771 CCTGGGGCCTTGGGCAATGAGGG - Intergenic
1097089974 12:56497282-56497304 CCTGGCAGCTGAGGCAGAGAGGG - Intergenic
1097090533 12:56500988-56501010 CCTGGCAGCTGAGGCAGAGAGGG + Intergenic
1098340714 12:69448148-69448170 CCTAGGAGCTGAGGCTGTGATGG + Intergenic
1101999929 12:109551012-109551034 CCTGGCACAGTTGGCAGTGAGGG - Intergenic
1102340322 12:112116494-112116516 CCTCACACCTTAGGCAGTGTTGG + Intergenic
1102453683 12:113058168-113058190 CCTGGCCCCTGAGGCAGTGGCGG + Exonic
1102634499 12:114311370-114311392 CCTGGGACAGGAGGGAGTGAGGG + Intergenic
1104030935 12:125065490-125065512 CCTGGGACCGGAGGAAGCGACGG - Exonic
1104171108 12:126281679-126281701 AATGGGACCTTCTGCAGTGAAGG - Intergenic
1105856363 13:24376090-24376112 CCTGGCAGCTGAGGCAGAGAGGG - Intergenic
1108055266 13:46479028-46479050 CCTGGCACCATAGGCAGCAAGGG + Intergenic
1110809025 13:79791411-79791433 CCTGGAACCTGAGTCTGTGAGGG + Intergenic
1112722270 13:102258506-102258528 TCTGGGAGCTTGGGCATTGATGG + Intronic
1113101469 13:106724312-106724334 CATGGGAAATTAGGCAGAGATGG + Intergenic
1113414616 13:110118393-110118415 CCTGGGACGGGAGGCAGTCAAGG - Intergenic
1113731413 13:112644338-112644360 GCTGTGGCCTCAGGCAGTGAGGG - Intergenic
1114492358 14:23111256-23111278 CCTGGAACCTAAGGCAGAGAAGG - Intergenic
1114651303 14:24286313-24286335 CCTGGGATGTGATGCAGTGAAGG - Intergenic
1115801883 14:37003930-37003952 CCTTGGGTGTTAGGCAGTGAAGG - Intronic
1117547266 14:56804054-56804076 CCTGGCCCCTTAGTGAGTGAAGG + Intronic
1117834677 14:59791385-59791407 GCTGGGACTTTAAGCAGTTACGG + Intronic
1122719476 14:103714288-103714310 CCTGGGGCCATTGGCAGTGCAGG - Intronic
1122903374 14:104791106-104791128 CCTGGGCCCCTGGGCAGTCAAGG + Intronic
1125364688 15:38901458-38901480 CTTGGGAGCTTAGGCATTCAAGG - Intergenic
1126530981 15:49710890-49710912 CCTGGAACCTGAGGCCATGATGG + Intergenic
1128262900 15:66244900-66244922 CCTGGGACCCAAGGCAGTGGGGG - Intronic
1129078971 15:73022984-73023006 CCAGGGACCTTGGGCAGTGTCGG + Intergenic
1130411595 15:83653357-83653379 CCTGGGACCTTTGGCAGCCAGGG - Intergenic
1132220845 15:100103950-100103972 CCTGTGACCTTCTTCAGTGAAGG - Intronic
1132464287 16:70672-70694 CCTGGGACCTTAGGCAGTGATGG - Intronic
1132519523 16:381050-381072 CCTTGGACCTCAGTCAGGGACGG + Intronic
1132938178 16:2492697-2492719 CCTGGGAGGGAAGGCAGTGAGGG - Intronic
1139342094 16:66274186-66274208 CCTGGGACCTTGGCCACTGGAGG - Intergenic
1140023584 16:71262759-71262781 CCCAGGACCTGAGGCAGTGCCGG + Intergenic
1141116173 16:81311778-81311800 CCTGGGAACATAGGCAGATAAGG + Intergenic
1141171930 16:81696973-81696995 TGTGTGACCTTAGGCAGTAACGG - Intronic
1142011210 16:87715155-87715177 CCTGGGACCTAAGGTTGTGAGGG + Intronic
1142143099 16:88481302-88481324 CCTGGGACCACCTGCAGTGAGGG - Intronic
1142384320 16:89753157-89753179 CCTGGCAGCTGAGGCAGAGAGGG - Intronic
1145225860 17:21127408-21127430 AGTGGCACCTTAGCCAGTGACGG + Intronic
1145732027 17:27198127-27198149 CCTGGCAGCTGAGGCAGAGAGGG - Intergenic
1146667558 17:34715225-34715247 AGTGGGAGCTTAGGCAGTGCTGG - Intergenic
1147583655 17:41640118-41640140 CCTGGGTTCTGAGGCAGAGATGG - Intergenic
1148485937 17:47991120-47991142 CCTGTGACCTTTGACGGTGAGGG - Intergenic
1154045346 18:10898948-10898970 CCTGGGTCCCTAAGCAATGAAGG + Intronic
1158292372 18:55956120-55956142 CATGTGACCTTAGGAATTGATGG + Intergenic
1158753971 18:60300153-60300175 CTTGGTACCTGTGGCAGTGATGG + Intergenic
1159918561 18:74206956-74206978 CCTGGGTGCTCAGCCAGTGAAGG - Intergenic
1160143441 18:76346629-76346651 CTGGGGACCTTGGGCAGTGCAGG - Intergenic
1160149708 18:76389826-76389848 CCTGGGACCTGAGGGGGAGATGG + Intronic
1160329915 18:77981745-77981767 CCTGTGTCCTTACGCTGTGACGG - Intergenic
1160797551 19:952947-952969 CCTGTGACCTTGGGCACTGCTGG + Intronic
1160848058 19:1175246-1175268 CCTGTGACTTGAGCCAGTGAAGG + Intergenic
1161841018 19:6680322-6680344 CTTGGGAGCTGAGGCAGTGGTGG + Intronic
1163034533 19:14563301-14563323 CCAGGGACCTTAGGGTGGGAGGG + Intronic
1163883414 19:19946450-19946472 CCTGGGCTCTGATGCAGTGAAGG - Intergenic
1164083474 19:21880533-21880555 CCTGGCAGCTGAGGCAGAGAGGG + Intergenic
1164084628 19:21889803-21889825 CCTGGCAGCTGAGGCAGAGAGGG + Intergenic
1164261565 19:23572396-23572418 CCTGGCAGCTGAGGCAGAGAGGG - Intronic
1165071056 19:33255039-33255061 CCTGCGACCTCGGGCAGTCAAGG - Intergenic
1168072217 19:53959579-53959601 CCTGGGCCCCAAGGGAGTGAGGG - Intergenic
925922479 2:8646901-8646923 CCTGGCACCCTAGGCGGTGTGGG - Intergenic
926431254 2:12787905-12787927 GCTGGAACCATAGGCAATGATGG + Intergenic
926436639 2:12844922-12844944 CGTGGGCCCTCAGGCAGTGGTGG - Intergenic
927897386 2:26792576-26792598 CCTGGGAGCTTAGGAACTGGCGG - Intronic
929996541 2:46829547-46829569 CCTAGGACGTGAGACAGTGACGG - Intronic
930498905 2:52185696-52185718 CCTGGAACCTGAGGCTGTCAGGG - Intergenic
930611328 2:53547330-53547352 GCTAGGACTTGAGGCAGTGAGGG - Intronic
930777565 2:55189443-55189465 CATTGGACATAAGGCAGTGAAGG + Intronic
931513247 2:63023089-63023111 GCTGGAACCCTGGGCAGTGAAGG + Intronic
933727167 2:85433556-85433578 CCTGGCACCTAAGGTAGGGAGGG - Intronic
936370065 2:111896514-111896536 CCTGGGACCTTAGGCTCAAATGG - Intergenic
937077627 2:119118372-119118394 GCTGGGACCTCAGGCAGGTAAGG - Intergenic
937810141 2:126190209-126190231 CCTGGCTCCATAGGCAGTCATGG - Intergenic
937906451 2:127055070-127055092 CCGGGGCCCTCAGGCAGTGCTGG + Intronic
939270898 2:139937966-139937988 CATTGGACATTAGGCAATGAAGG - Intergenic
944122129 2:196251604-196251626 CCTGGTAGCCTAGGTAGTGAGGG + Intronic
945978018 2:216285677-216285699 CAAGGGCCCTTAGGCCGTGATGG - Intronic
946124867 2:217553652-217553674 CCTGTGTCCTCAGGCAATGAGGG + Intronic
946315185 2:218906688-218906710 CCTGAGGCCTGAGGGAGTGAGGG - Intergenic
948860849 2:240752013-240752035 CCTGGGCCATTTTGCAGTGAGGG - Intronic
1169652072 20:7880334-7880356 CCTGAGACCTGTAGCAGTGATGG - Intergenic
1172219303 20:33261908-33261930 CCTGGGACTTTGGCCATTGAAGG - Intergenic
1175074816 20:56363337-56363359 CCTGGGTCATGAGGCAGTGAGGG + Intronic
1178077941 21:29029769-29029791 ACTGCGACCTCAGGGAGTGAAGG - Intronic
1178273046 21:31211157-31211179 CCCTGGTCCTCAGGCAGTGATGG - Intronic
1178521005 21:33288531-33288553 CCTGGGGCTTTGGGCAGTGAAGG - Intronic
1178639842 21:34337118-34337140 CCTGAGACCTTGGCCAGTGCTGG + Intergenic
1182948845 22:34352276-34352298 CCTGGGTCCCTTGGGAGTGAGGG - Intergenic
1183425307 22:37735911-37735933 CCTGGGACTGTAGCCAGTGTGGG + Intronic
1184240571 22:43209505-43209527 CTTGAGACTTTAGGGAGTGAAGG - Intronic
951983828 3:28595687-28595709 CCTGGGATCTCAGGCAGAGACGG - Intergenic
954373918 3:50184405-50184427 CCTGGGACCTTGGCCAGAGCAGG + Intronic
955727535 3:61949060-61949082 CATGGGACCTTAGCATGTGATGG + Intronic
956504215 3:69920583-69920605 CCTGGCAGCTGAGGCAGAGAGGG - Intronic
956579811 3:70797505-70797527 CCTGGGCCCATTGGCAGTGCCGG + Intergenic
958657274 3:97018534-97018556 CCTGGCAGCTGAGGCAGAGAGGG + Intronic
960435601 3:117622758-117622780 AATGGGACCTTAGGCGATGACGG + Intergenic
962848432 3:139290201-139290223 CCTGGGCCCTTAGGCAGGACAGG - Intronic
965080189 3:164023638-164023660 CCTGGGCTCTGATGCAGTGATGG + Intergenic
966715880 3:183012516-183012538 CCTGGGCCACTAGGCAGAGAAGG - Intergenic
968461820 4:730046-730068 CCTGGGGCCTCAGACAGGGAGGG - Intronic
968983177 4:3861558-3861580 CCTGGGGACGTAGCCAGTGATGG + Intergenic
969717994 4:8877657-8877679 CCGGGGAGCTGAGGCAGTCATGG + Intergenic
971185387 4:24370934-24370956 CCAGGGACTTTCGGGAGTGAGGG - Intergenic
972217321 4:36911480-36911502 CGTGTGACCTTAGGAATTGATGG + Intergenic
973201906 4:47513310-47513332 CCTGTGAGTTTAGGCACTGAAGG + Intronic
974108936 4:57503775-57503797 CCTGGGAACTCAGGGACTGAGGG - Intergenic
975732764 4:77353930-77353952 TCTGGGACCTAATGCAGTGTTGG + Intronic
975734354 4:77367026-77367048 TCTGGGACCTAATGCAGTGTTGG + Intronic
976842971 4:89453179-89453201 CCCGGGACCTTAGTAAGTAAGGG - Intergenic
979033169 4:115678506-115678528 CCTCAGGCCTTGGGCAGTGATGG + Intergenic
980009384 4:127579356-127579378 CCTGGGAAATGAGTCAGTGAAGG + Intergenic
982024056 4:151234449-151234471 CCTGGGAAGTAAGGCAGGGAGGG + Intronic
982771539 4:159401369-159401391 GCTTGGATCTTAGGCATTGACGG + Intergenic
983398923 4:167238049-167238071 TATAGGATCTTAGGCAGTGAAGG - Intergenic
984647852 4:182238591-182238613 CTTAGGACCTGGGGCAGTGACGG + Intronic
984684441 4:182650259-182650281 CCTGAGACCCAGGGCAGTGAGGG + Intronic
985821971 5:2166627-2166649 CCTGGGAGCTGGGGCAGTGGTGG - Intergenic
986569521 5:9150657-9150679 CCTGGGACCTCAGGCGGCGGGGG - Intronic
988035585 5:25823570-25823592 CCATGGGCCTTGGGCAGTGAGGG - Intergenic
991675894 5:69089678-69089700 CATGTGACCTTAGGAATTGATGG - Intergenic
992198558 5:74363062-74363084 CCTGGGAAGTGAGGCACTGATGG - Intergenic
992238401 5:74736795-74736817 CCTGGCTGCTTAGACAGTGATGG + Exonic
992516017 5:77492655-77492677 CCTGGTACCCTAGGAAGTGGAGG - Intronic
992864313 5:80942122-80942144 CATGGGACCATAGGCAATAAAGG + Intergenic
993448340 5:88042761-88042783 CCTGGTTCCTTAGGAAGTCAAGG - Intergenic
998223866 5:140311053-140311075 CCTGGGAACTTTGGCACTGTGGG - Intergenic
999280867 5:150364755-150364777 CCTGGGACCTTAGGAGAAGAAGG - Intronic
999930192 5:156423886-156423908 CCTGGTACATTAGTCAGTGATGG + Intronic
1002663052 5:180803813-180803835 CATGGGACCCCAGGCGGTGAGGG + Intronic
1002966635 6:1972781-1972803 CATTGGAACTTAAGCAGTGATGG - Intronic
1003268422 6:4586907-4586929 CCTGGGGCCTTTGTCAGAGAAGG - Intergenic
1003369007 6:5506584-5506606 TCTGGAATCTTAGGCAGTGGTGG - Intronic
1004606819 6:17202631-17202653 CCCGGGACCTTTGGAAGAGAAGG - Intergenic
1005854566 6:29851223-29851245 CCTGTGAGCCTAGGCAGGGAGGG + Intergenic
1006084654 6:31587356-31587378 CCTGGGAGCTTAGGAAGTGATGG + Intronic
1006167011 6:32071006-32071028 CCGGGGAGCTCAGGCAGGGAAGG + Intronic
1006361452 6:33589517-33589539 CCTGGGAACTTAGGGAGGGAGGG - Intergenic
1007103647 6:39268570-39268592 CCTGGGACCTGAGGTGGTGGTGG + Intergenic
1007987658 6:46223411-46223433 CCTGTGATCTTATGCAGGGATGG + Intronic
1010899137 6:81404096-81404118 CCTGTGACCTCAGCCTGTGAAGG - Intergenic
1012047809 6:94301031-94301053 CCATGGGCCTGAGGCAGTGATGG + Intergenic
1020153764 7:5704784-5704806 ATGGGGACCTGAGGCAGTGACGG - Intronic
1020272689 7:6606660-6606682 CCTGGGACCTGAAGCTGGGAAGG + Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1022400147 7:30028705-30028727 CTTGGGGCCTGGGGCAGTGAGGG + Exonic
1024897323 7:54275153-54275175 CCTGGGGCCCTAGCCAGGGAGGG - Intergenic
1027677937 7:81182199-81182221 CCTGGGCACTTAGCCAGTGCAGG + Intronic
1032150180 7:129422297-129422319 CCTGGGACCTTCGGATATGAGGG + Intronic
1037431070 8:18813722-18813744 TCTGGGACCTTAGGTAGGTAAGG + Intronic
1037520474 8:19675814-19675836 CCTGAGACCTTGGGCAGAGTGGG - Intronic
1039389417 8:37165405-37165427 CCAGAGGCTTTAGGCAGTGAAGG + Intergenic
1039807199 8:41010602-41010624 CTTGGGACGTGAGGCAGTGATGG - Intergenic
1044751463 8:95420511-95420533 CTTGGGACCTCAGGAACTGAGGG - Intergenic
1044837870 8:96313656-96313678 CCTGGGCCCTCAGGCAGGGTAGG - Intronic
1046586108 8:116150153-116150175 ACTGTTGCCTTAGGCAGTGAAGG + Intergenic
1048211361 8:132457039-132457061 CCAGGAGCCTTAGGCAGTCACGG + Intronic
1048260269 8:132939165-132939187 AATGGAACCTTTGGCAGTGATGG + Intronic
1049275713 8:141719123-141719145 CCTGGGGCCAGAGGCAGTGAGGG + Intergenic
1049830598 8:144699147-144699169 CCTGGGAGATGGGGCAGTGAGGG + Intergenic
1051365938 9:16321501-16321523 CTGGGGACCTCAGGCATTGAAGG + Intergenic
1052343105 9:27382340-27382362 CCTGGGGCTTTAGGCAGAGAAGG - Intronic
1052530810 9:29682171-29682193 CCTAGGCCCTTGGACAGTGATGG - Intergenic
1055672996 9:78625926-78625948 TCTGAGACCTTAGGAAATGAAGG + Intergenic
1058727588 9:107818158-107818180 CCTCAGCCCTTGGGCAGTGATGG - Intergenic
1059446305 9:114340227-114340249 CCTGGGTGTGTAGGCAGTGAGGG - Intronic
1061659679 9:132120700-132120722 CCTGGGACCTAAGGAAATAAAGG + Intergenic
1062399873 9:136367609-136367631 CCTGGGGCCTGCGGCAGGGAGGG - Intronic
1186283422 X:8018775-8018797 CCAGGGGCCTAAGGCAGAGAGGG - Intergenic
1186792829 X:13015647-13015669 CCTGGAAGCTTAAGCAATGATGG - Intergenic
1186821799 X:13296423-13296445 CCTGGGACCTTAGAAATTGTTGG - Intergenic
1192235638 X:69293916-69293938 CCTGGGACCTAAGCCTGTGGAGG + Intergenic
1193261729 X:79415253-79415275 CCTGGGACATTGGCCAGAGAAGG - Intergenic
1193960972 X:87924456-87924478 CCTGAGAACTTAGGCAGGAACGG - Intergenic
1194569111 X:95531167-95531189 CCTGGGACCACAGGCAATGCTGG + Intergenic
1200215921 X:154368241-154368263 CCTGGGACCCTGGGCAGAGAGGG - Intronic