ID: 1132465983

View in Genome Browser
Species Human (GRCh38)
Location 16:77698-77720
Sequence CGGGGGCCTCCGCACAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132465961_1132465983 23 Left 1132465961 16:77652-77674 CCCTCCTTCCTTCCCCCGACCAG 0: 1
1: 0
2: 6
3: 72
4: 813
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465960_1132465983 28 Left 1132465960 16:77647-77669 CCGCTCCCTCCTTCCTTCCCCCG 0: 1
1: 4
2: 53
3: 605
4: 4397
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465967_1132465983 9 Left 1132465967 16:77666-77688 CCCGACCAGCCTGTGACAACCCC 0: 1
1: 0
2: 4
3: 23
4: 346
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465965_1132465983 11 Left 1132465965 16:77664-77686 CCCCCGACCAGCCTGTGACAACC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465973_1132465983 0 Left 1132465973 16:77675-77697 CCTGTGACAACCCCGGCCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465968_1132465983 8 Left 1132465968 16:77667-77689 CCGACCAGCCTGTGACAACCCCG 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465962_1132465983 22 Left 1132465962 16:77653-77675 CCTCCTTCCTTCCCCCGACCAGC 0: 1
1: 0
2: 3
3: 59
4: 629
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465964_1132465983 15 Left 1132465964 16:77660-77682 CCTTCCCCCGACCAGCCTGTGAC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465970_1132465983 4 Left 1132465970 16:77671-77693 CCAGCCTGTGACAACCCCGGCCA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465963_1132465983 19 Left 1132465963 16:77656-77678 CCTTCCTTCCCCCGACCAGCCTG 0: 1
1: 0
2: 3
3: 46
4: 463
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465966_1132465983 10 Left 1132465966 16:77665-77687 CCCCGACCAGCCTGTGACAACCC 0: 1
1: 0
2: 0
3: 6
4: 153
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1132465979_1132465983 -10 Left 1132465979 16:77685-77707 CCCCGGCCAGGGGCGGGGGCCTC 0: 1
1: 0
2: 3
3: 39
4: 392
Right 1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132465983 Original CRISPR CGGGGGCCTCCGCACAAGCC TGG Intronic