ID: 1132471217

View in Genome Browser
Species Human (GRCh38)
Location 16:104435-104457
Sequence CTATGGGTATGGAGAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132471211_1132471217 -6 Left 1132471211 16:104418-104440 CCAGGAACAAGTTCCAGCTATGG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 15
4: 225
1132471210_1132471217 6 Left 1132471210 16:104406-104428 CCTCATGGAAAGCCAGGAACAAG 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132471217 Original CRISPR CTATGGGTATGGAGAAATGA GGG Intronic
900132736 1:1094910-1094932 CTTTGTGTATGGTGAAATGCAGG + Intronic
901690278 1:10968681-10968703 AGGTGGGGATGGAGAAATGACGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903681326 1:25099216-25099238 CCTTGTGTATGGAGAAAAGATGG - Intergenic
906078123 1:43067070-43067092 CTATGGGCCTGGAAAAAGGAGGG + Intergenic
906701675 1:47864182-47864204 CTGTGGGTTTGGACAAATGGTGG - Intronic
906968132 1:50480405-50480427 CTATGAGTATGTATAAATAACGG + Intronic
909783488 1:79580208-79580230 CTGAGGGTAGAGAGAAATGAGGG - Intergenic
912394867 1:109334525-109334547 CTTGGGGTATGGGGAGATGAAGG + Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
914678259 1:149920338-149920360 CCATGGATATGGAGGACTGATGG - Intergenic
915031930 1:152887005-152887027 CTATGGGTCTGCAGGAATGGTGG + Intergenic
915187341 1:154117724-154117746 CTTTCGATATGGAGAAATTAAGG - Exonic
916752391 1:167734884-167734906 ATATTGGAATGGAGAAATGTGGG - Intronic
918462315 1:184789300-184789322 CTGTGGGTATGCACAAATGATGG + Intergenic
921448514 1:215274826-215274848 CTATGTGTATGGAGAAAAAGAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063907496 10:10796189-10796211 ATTTGGGTGTGGAGAAATTAAGG - Intergenic
1064018238 10:11789165-11789187 CTCTGGGTTTGGAGAAATACAGG + Intergenic
1065406755 10:25375300-25375322 GTATGGGTTGGGAGAAATGATGG - Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1070345194 10:75534921-75534943 TTATGGGTATAGAGAAATTCTGG - Intronic
1072473709 10:95738032-95738054 TTCTGGGTAGGGAGAAAGGAAGG + Intronic
1073799851 10:107029465-107029487 CTGTGGTTATGGAGAATTGCAGG - Intronic
1074269688 10:111941734-111941756 CCATGGGTTTGGAGAAAAGCAGG - Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1079712314 11:23701162-23701184 CTCGGGGTATGGAGAGATAAAGG - Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081996139 11:47365317-47365339 CTACCGGTCTGTAGAAATGAGGG - Intronic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1082912805 11:58395818-58395840 CTATGAGTTTGGACAAATGCAGG - Intergenic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1085197728 11:74682552-74682574 TGATGGGTATGAAGAAGTGATGG + Intergenic
1085404135 11:76251743-76251765 CTGGGGGAATGGGGAAATGAGGG + Intergenic
1085858136 11:80198977-80198999 CTATGGAGAGGGAGAGATGAGGG - Intergenic
1087239014 11:95754827-95754849 CAATGGGTAAGGAGAAACCAAGG - Intergenic
1089916269 11:122159934-122159956 ATAGGGGTATGGAGAAATGAAGG - Intergenic
1091367229 11:135032474-135032496 CAATGAGTAGGAAGAAATGAGGG - Intergenic
1091423887 12:368928-368950 CTATGAGTGTGGACAAATGGAGG + Intronic
1092635835 12:10447600-10447622 CCATGAGGATGGTGAAATGATGG + Exonic
1094088490 12:26621158-26621180 CTATGAGAATGGAGAAATAGGGG - Exonic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1097775896 12:63645382-63645404 ATATGCAGATGGAGAAATGAAGG - Intronic
1098614193 12:72502856-72502878 ATGTGAATATGGAGAAATGAGGG + Intronic
1099454640 12:82849001-82849023 GCATGCGTATGGAGAAGTGATGG + Intronic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1101220779 12:102637580-102637602 CTATAGGTAGGGAGGAAGGAGGG - Intergenic
1103909303 12:124343335-124343357 CTAAGGCAATGAAGAAATGAAGG - Intronic
1104221925 12:126793302-126793324 TCATGAGTATGAAGAAATGAGGG + Intergenic
1106423166 13:29600813-29600835 CTATGGGTTTTGACAAATGCTGG - Intergenic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1107597916 13:41982607-41982629 CTTTAGTTATGGAGATATGACGG - Intergenic
1109708998 13:66139406-66139428 CGATGGTAATGTAGAAATGAAGG - Intergenic
1110717563 13:78724132-78724154 CTATAGGTCTGGGGAAATCAAGG + Intergenic
1111194881 13:84861402-84861424 CAATTGCTGTGGAGAAATGAAGG - Intergenic
1112168095 13:96941431-96941453 GTAAGTGTTTGGAGAAATGAGGG - Intergenic
1112525941 13:100147112-100147134 ATATGGATATGCAGAAATAAAGG - Intronic
1113233091 13:108237340-108237362 TTATGAGTGTGGAGGAATGAGGG + Intergenic
1116159927 14:41254613-41254635 GCATGGGAATGGAGAAATGGAGG + Intergenic
1116446873 14:45021296-45021318 ATATGGGTATGGGGCAGTGAAGG + Intronic
1116692696 14:48130911-48130933 CTATAGGTATTGTCAAATGATGG + Intergenic
1119256895 14:73206298-73206320 CGATTTGTGTGGAGAAATGATGG + Intronic
1119716905 14:76866217-76866239 CTCTGGGTCTAGATAAATGAGGG - Intronic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1122438066 14:101712518-101712540 CAGTGGGTGGGGAGAAATGACGG - Intergenic
1126841060 15:52717879-52717901 CTATGCATAGGTAGAAATGATGG - Intergenic
1126950197 15:53872367-53872389 GTAAGGGGTTGGAGAAATGAGGG + Intergenic
1128371749 15:67044683-67044705 CTATGGTGAAGGGGAAATGATGG + Intergenic
1130554491 15:84913290-84913312 CTTGGGGTCTGGAGACATGAGGG + Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1135353217 16:21747930-21747952 GTTTGGCTATGGAGAAAAGATGG - Intronic
1135451704 16:22564053-22564075 GTTTGGCTATGGAGAAAAGATGG - Intergenic
1138638842 16:58366134-58366156 CTCAGGGGATGGAGAAGTGAGGG + Intronic
1139772187 16:69287003-69287025 TTATGGCTATGGAAAAATAAAGG + Intronic
1140929160 16:79611036-79611058 ATTTGGGTATGTGGAAATGAGGG - Intergenic
1141301105 16:82816441-82816463 CAAAGGCTATGGAGAAATCAAGG + Intronic
1142761111 17:2042351-2042373 GTATGGGTCGCGAGAAATGAAGG - Intronic
1142989282 17:3718763-3718785 GCATGGGAAGGGAGAAATGAAGG + Intronic
1148218014 17:45844560-45844582 CCATGGGTAAGGAGAAAAGTTGG + Intergenic
1149801417 17:59571560-59571582 CTAGGGGGAGGGAGAAATGGGGG - Intronic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1150739639 17:67769085-67769107 CTATTGGTCTGGTGAAATAAAGG - Intergenic
1151186514 17:72368579-72368601 TTATGGGGATGCAGAAATGAGGG - Intergenic
1151278679 17:73055599-73055621 ATTTGTGTATGTAGAAATGAGGG + Intronic
1155069255 18:22298991-22299013 CTGGCTGTATGGAGAAATGATGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156554232 18:38049068-38049090 CCATGGGTATAGAGAACTGAGGG - Intergenic
1157124643 18:44944626-44944648 GCCTGGGTATGGAGCAATGAGGG - Intronic
1157155085 18:45257666-45257688 CTATGAGGTTGGAGAAATGGAGG - Intronic
1157580112 18:48769143-48769165 CGGTGGGTGTGCAGAAATGAGGG - Intronic
1158095967 18:53771426-53771448 CTTTGGGAATTGGGAAATGATGG + Intergenic
1160580721 18:79883349-79883371 TTATGGGTCTGGACAAATCACGG - Intronic
1164410237 19:27996599-27996621 CTAATGGTAAGGAGAAATTAAGG - Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1166931841 19:46305673-46305695 CAAAGGGTATGGAGAATGGATGG + Intronic
1167239666 19:48336037-48336059 ATATTGGTAAGGAGAAATGAGGG + Intronic
1167399661 19:49256343-49256365 CCAGGGCTTTGGAGAAATGAGGG + Intergenic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
1168699817 19:58430936-58430958 CTCTGGTGATGGAGAAAGGAAGG + Intergenic
926457239 2:13081891-13081913 CTGGGACTATGGAGAAATGAAGG - Intergenic
927030411 2:19115687-19115709 ATATGGGTATGGAGAAATATAGG - Intergenic
929357891 2:41048700-41048722 CTTTGGGTATGTAGAAATAAAGG - Intergenic
930157672 2:48122376-48122398 CTAGGGGGAGGGAGAAATGGGGG + Intergenic
930208041 2:48607947-48607969 CTATGGGTACGGATGAATGCAGG + Intronic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
931617160 2:64171368-64171390 CTATGGGGACGGAGCAGTGAGGG + Intergenic
932293651 2:70606555-70606577 CTTTGAGTCTGGAGAAATGGAGG + Intergenic
935053594 2:99545329-99545351 CTATGGGCATCTAGAAATAAAGG + Intergenic
936780605 2:116028521-116028543 CTTTGGGCATTGAGAAATGCAGG + Intergenic
937610253 2:123852702-123852724 TTGTGGGTTTGCAGAAATGAGGG + Intergenic
937983469 2:127628200-127628222 CTGTGGGTCTGGACAAATGAAGG - Intronic
939103787 2:137926039-137926061 ATTTGGGTATGGAGATATTATGG - Intergenic
939352917 2:141063874-141063896 CTTTGGCCATGGAGAAATGAAGG + Intronic
940029632 2:149247912-149247934 CTATTGGAATGGATAAATTATGG - Intergenic
940177011 2:150889628-150889650 CTATGAGGTTGGAGAACTGAAGG - Intergenic
941448975 2:165635879-165635901 AAATGGGTATGGAGCAAGGAAGG - Intronic
942580046 2:177408489-177408511 CTATCTGGAAGGAGAAATGAGGG - Intronic
942682481 2:178492199-178492221 TTATAGGTATTGAGAAATGAAGG + Intronic
946007325 2:216536632-216536654 CTTTTCGTATGAAGAAATGAAGG + Intronic
946721262 2:222611148-222611170 CAATGGGATTTGAGAAATGAAGG - Intronic
947343423 2:229164669-229164691 CCCTGGGTATGAAGCAATGAAGG + Intronic
1169255013 20:4090607-4090629 GTATGGGCAGGGAGAAATGATGG - Intergenic
1169693627 20:8361596-8361618 CCACTGGTGTGGAGAAATGAAGG + Intronic
1170315520 20:15036701-15036723 CTTTGGGTATAGAAAGATGATGG - Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179315350 21:40239095-40239117 CTAGAGATAGGGAGAAATGATGG - Intronic
1180691984 22:17724454-17724476 CTATGAGTATGGAATAATCAGGG - Intronic
1181618754 22:24072954-24072976 ATATGGGTATGGGGAAATAGAGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183756337 22:39769724-39769746 CAATGGGTTTTGAGAAAGGAGGG - Intronic
950753660 3:15153927-15153949 CTATGGTAATGGTGGAATGATGG - Intergenic
952087115 3:29837476-29837498 TTATGGGTAAGGAGAAAACAGGG - Intronic
952593141 3:34981417-34981439 ATATGGGTATAGAGATTTGATGG - Intergenic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954885222 3:53867500-53867522 CTCTGGATGTGGAGAAATGCCGG - Exonic
960841936 3:121967947-121967969 CTATGGGTTTTGACAAATGTGGG + Intergenic
962036929 3:131661961-131661983 CTATGGGTTTGGGGGAATTATGG + Intronic
963560916 3:146863714-146863736 CTCTGGGCATGGAGAAACAAAGG - Intergenic
966270944 3:178104861-178104883 CTCTTGGCATTGAGAAATGAAGG - Intergenic
966547900 3:181171357-181171379 CTGTGGGTAGGAAGAAAGGAAGG + Intergenic
969121476 4:4914547-4914569 CTTTGGGTCTGAAGAGATGAGGG + Intergenic
970143019 4:13003215-13003237 CTTTGGAGATGGAGGAATGAAGG - Intergenic
970725126 4:19034846-19034868 CTGTGGCTGTGGAGAAATTATGG + Intergenic
970766538 4:19556203-19556225 CTAGGGGTATAAAGACATGAAGG - Intergenic
970951273 4:21758511-21758533 ACATGGGTTTAGAGAAATGATGG - Intronic
973690305 4:53421398-53421420 CTATGAGCATAGAGAAAAGATGG - Intronic
973809528 4:54556675-54556697 CAATGGGGCTGGACAAATGAAGG + Intergenic
973851146 4:54962922-54962944 GTATGGGAAAGGAGAAGTGATGG + Intergenic
974163915 4:58175514-58175536 CTATGAAGATGTAGAAATGATGG - Intergenic
975401967 4:73949035-73949057 CTATGTGGATGGACAGATGAGGG + Intergenic
976213701 4:82695488-82695510 CTAGGGAAATGGAGAAATCATGG + Intronic
977157866 4:93595645-93595667 CTATAGGTAAGAAGAAATCAGGG - Intronic
981447612 4:144858233-144858255 GGATGGGAATGGGGAAATGAAGG + Intergenic
981953238 4:150437075-150437097 CTAGACTTATGGAGAAATGATGG - Intronic
982202815 4:152975718-152975740 CTCTGGGGTTGGAGAAATGGGGG + Exonic
982418391 4:155164065-155164087 GTATGGGTATGGAGACACCAGGG + Intergenic
987597092 5:20015817-20015839 CTATTGGTTTGGAAAAAGGACGG + Intronic
989149268 5:38282638-38282660 TTATGGGTATGGCCAAATGTGGG - Intronic
990159971 5:52927016-52927038 TTATGGGTATGTAAAAATAATGG + Intronic
990926278 5:61028354-61028376 TTATGAGCATGGAGAAGTGATGG - Intronic
991644027 5:68782612-68782634 CTATGGGACTGTAAAAATGAGGG + Intergenic
992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG + Intronic
992350665 5:75925513-75925535 CTATGTGTATGGAGATTGGAAGG - Intergenic
994873246 5:105380548-105380570 TTATGGGTATTGAGACAAGACGG + Intergenic
999434302 5:151551191-151551213 CTATGGGTATAGGGGGATGATGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003710168 6:8580611-8580633 CTATGAGTTTAGACAAATGAAGG - Intergenic
1003869183 6:10388351-10388373 CTATAGGGATGTGGAAATGAGGG + Intergenic
1004730044 6:18348676-18348698 CTATGGCTGTGGAGAAAGAATGG + Intergenic
1004790026 6:19015129-19015151 CTAGGGTTAAGGAGGAATGAAGG + Intergenic
1004843656 6:19614706-19614728 CCCAGGGTATGGAGATATGAGGG - Intergenic
1005776598 6:29138867-29138889 CTATGGGTATCGACAAAACATGG + Intergenic
1006338691 6:33433886-33433908 CTAGGGGCATGGAATAATGAGGG - Intronic
1007755763 6:44098345-44098367 CCATGTGTATGGGGGAATGAGGG - Intergenic
1007915668 6:45559390-45559412 CTTTTGGAATGGAGAAATTATGG + Intronic
1007952945 6:45888248-45888270 CTATGGCTATGGAGAATTCCTGG - Intergenic
1011105078 6:83770237-83770259 CCATAGGCATGGAGAAATTATGG - Intergenic
1011524863 6:88253598-88253620 ATATTGTTATGGAGAACTGAAGG + Intergenic
1012889506 6:104882706-104882728 CTACAGGTAGGGGGAAATGAAGG - Intergenic
1012936787 6:105376413-105376435 CTCTAGGTAGAGAGAAATGATGG - Intronic
1013057086 6:106593922-106593944 ATATAGGTATAGAGAAAGGATGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013640466 6:112072344-112072366 CTAGGGATATAAAGAAATGAAGG + Intronic
1014340306 6:120197363-120197385 CTAAGGGCTTGGAGGAATGAGGG + Intergenic
1015549491 6:134397133-134397155 GGATGGGTGTGGAAAAATGAGGG - Intergenic
1017538790 6:155378083-155378105 CTATGCATATGAAGAATTGAAGG + Intergenic
1019846583 7:3508852-3508874 ATTTGGGGATGGATAAATGAAGG + Intronic
1021347093 7:19542095-19542117 CTCTGGGTGTAGAGAAAGGAAGG + Intergenic
1022934796 7:35162977-35162999 ATATGCAGATGGAGAAATGAAGG - Intergenic
1023704627 7:42928752-42928774 CTATGTGTTTGGAGCAAGGAGGG - Intronic
1023762904 7:43483398-43483420 CTATGGGTGTGTGGAAATGCTGG - Intronic
1024120763 7:46236157-46236179 CTATGGGTTTGCAGAATGGAGGG + Intergenic
1027592114 7:80130737-80130759 CTGTGGGACTGGAGAATTGATGG + Intergenic
1027969233 7:85057343-85057365 GTATGGTTATTGAGAAATGAAGG + Intronic
1028093000 7:86726363-86726385 CTCTGGATAAGGGGAAATGATGG + Intronic
1029304868 7:99611700-99611722 CTCTGGCTATAGGGAAATGATGG - Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030650800 7:112113956-112113978 CTAGGGGTAAAGAAAAATGATGG - Intronic
1032471789 7:132184285-132184307 CTATGAGAGTGGACAAATGAGGG + Intronic
1032703646 7:134403824-134403846 CTGTGGGGATGAAGAAATGTGGG + Intergenic
1033046736 7:137968884-137968906 CTAGGGGGTTGGAGAAAAGAAGG + Intronic
1035140305 7:156752949-156752971 GTAGGGGGATGGGGAAATGATGG + Intronic
1038778889 8:30554326-30554348 CTGTGGGTGTTGAGAAATGCTGG - Intronic
1039550341 8:38438881-38438903 CTATGGGCTTGAGGAAATGAGGG - Intronic
1041570058 8:59327752-59327774 TTTTGGGTGTGGAGAAATCATGG - Intergenic
1042976126 8:74471667-74471689 GGATGGGGATGGAGAAAGGATGG - Intronic
1044479729 8:92671340-92671362 GTATGGGTAAGGAGCAAGGAAGG - Intergenic
1044900287 8:96936854-96936876 CTATGGGAATGGAGAAATCAAGG - Intronic
1046133415 8:109996363-109996385 CTGTGGGTAATGAGAAATGCTGG - Intergenic
1047356642 8:124128521-124128543 CTAGGGGGAGGGAGAAATGGGGG - Intergenic
1048177871 8:132169416-132169438 CTATGGTTATGGAAAAGGGAAGG - Intronic
1048754507 8:137722049-137722071 CTAGGGGTATGGAAGAAGGAAGG + Intergenic
1050114387 9:2248608-2248630 CTATGGATCAGGAGAAAAGAGGG - Intergenic
1051106145 9:13582646-13582668 ATATGGCTAGGGAGAAGTGAAGG - Intergenic
1051662081 9:19435092-19435114 CTAAGGGTAGGCAGGAATGATGG - Intronic
1052692522 9:31833537-31833559 CTGTGGATATGGATAAATGGAGG - Intergenic
1052748613 9:32465751-32465773 CAATGGGTCTGGAGAAAGTATGG + Intronic
1053859321 9:42370999-42371021 CTATGGGCATGGAGAGGTGCAGG - Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1056913148 9:90721322-90721344 CATTGGGTAATGAGAAATGAAGG - Intergenic
1059618146 9:115973426-115973448 CTATGAGTAATGAGAAATAATGG + Intergenic
1059802893 9:117768591-117768613 CAATGGGGATGGGGAAAAGACGG + Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062445162 9:136590592-136590614 CTATGGGGAGGCAGAGATGATGG - Intergenic
1186613958 X:11167019-11167041 ATTTGGGCATGGAGAAATTAAGG - Intronic
1188074207 X:25755269-25755291 ACATGTGTATGGAGAAATTATGG + Intergenic
1188568119 X:31550175-31550197 CCATGGCAATGGAGAATTGATGG - Intronic
1189003124 X:36966376-36966398 CTAGGGGTAGGGAGACAGGATGG - Intergenic
1190407621 X:50103311-50103333 CTGTGTGTATGTGGAAATGAGGG + Intergenic
1190429704 X:50367463-50367485 ACATGGGCCTGGAGAAATGAAGG - Exonic
1195890708 X:109690691-109690713 CTTTGGGTATGAAGAAATACTGG + Intronic
1196462106 X:115942342-115942364 AAATGGGCATGGAGAAAGGAAGG + Intergenic
1196815130 X:119659424-119659446 CTTTGGGTTTGGTGATATGAAGG - Intronic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198395255 X:136213274-136213296 CTAAGGCTCAGGAGAAATGAGGG + Intronic
1198730472 X:139722512-139722534 ATTTGGGAATGGAGAAAGGAAGG + Intergenic
1198871656 X:141182200-141182222 CAATGGGTGTGGTGAATTGAAGG + Intergenic
1201292584 Y:12435847-12435869 TTGTGGGTACGGAAAAATGATGG - Intergenic
1201737940 Y:17290437-17290459 CACTGGTTAAGGAGAAATGAGGG - Intergenic
1202132325 Y:21624469-21624491 TTATGGGTTTACAGAAATGAGGG - Intergenic