ID: 1132471636

View in Genome Browser
Species Human (GRCh38)
Location 16:107051-107073
Sequence GGACCCAAGACTGTTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132471622_1132471636 30 Left 1132471622 16:106998-107020 CCTGGACTCCTGCCAGAGAAACA 0: 1
1: 0
2: 1
3: 31
4: 327
Right 1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 88
1132471630_1132471636 -6 Left 1132471630 16:107034-107056 CCCTGGGGCAAGCTCCAGGACCC 0: 1
1: 0
2: 4
3: 17
4: 212
Right 1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 88
1132471623_1132471636 22 Left 1132471623 16:107006-107028 CCTGCCAGAGAAACATAGCTGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 88
1132471631_1132471636 -7 Left 1132471631 16:107035-107057 CCTGGGGCAAGCTCCAGGACCCA 0: 1
1: 0
2: 2
3: 20
4: 265
Right 1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 88
1132471628_1132471636 1 Left 1132471628 16:107027-107049 CCAGCATCCCTGGGGCAAGCTCC 0: 1
1: 0
2: 0
3: 30
4: 308
Right 1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 88
1132471624_1132471636 18 Left 1132471624 16:107010-107032 CCAGAGAAACATAGCTGCCAGCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132471636 Original CRISPR GGACCCAAGACTGTTAGGGT GGG Intronic
902657478 1:17879273-17879295 GGTCCCAAGAGTGCTAGGGGAGG - Intergenic
905480370 1:38257752-38257774 GGAGGCGAGACTGCTAGGGTTGG - Intergenic
1064993718 10:21278495-21278517 GGACCCATAACTGCTAGGGCTGG + Intergenic
1069310890 10:67034798-67034820 GGAGGCAAGACTGATATGGTAGG - Intronic
1069952080 10:72026011-72026033 GAATCCAAAGCTGTTAGGGTGGG - Intergenic
1079263889 11:18911368-18911390 GTACCCAAGACTGGGATGGTTGG + Intergenic
1080800462 11:35605386-35605408 GGACCCAAGACTGGCAGCTTTGG - Intergenic
1081356975 11:42123763-42123785 GGACAAAAGAGTGTAAGGGTTGG - Intergenic
1084102314 11:66957928-66957950 GAACCCAAGTCTGTCAGGATCGG - Intronic
1084696333 11:70757782-70757804 GGACCCCAGAATGTGTGGGTGGG + Intronic
1092924690 12:13262493-13262515 GGACAAAAGAGTGTTCGGGTTGG + Intergenic
1093729714 12:22553633-22553655 GGAACCAAGATTTTCAGGGTTGG + Intergenic
1094666185 12:32523496-32523518 GGACCGAGGACTGTCATGGTAGG + Intronic
1098387560 12:69934976-69934998 GGACCCAACCCTGTTTGGCTAGG + Intronic
1103658249 12:122491998-122492020 GAACCCAAGGCTCTGAGGGTTGG - Intronic
1125919446 15:43516998-43517020 GGTCCCTAGCCTGTTGGGGTGGG - Intronic
1127368999 15:58318729-58318751 GGTGCCAAGACTGCCAGGGTGGG + Intronic
1128262898 15:66244896-66244918 GGACCCAAGGCAGTGGGGGTGGG - Intronic
1131776119 15:95800794-95800816 GAACCCAATAGTGGTAGGGTGGG + Intergenic
1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG + Intronic
1133033213 16:3021349-3021371 GGACCCCAGACTGGGAGGGAGGG + Intronic
1133149876 16:3819795-3819817 TAACCCAAGAATGTTAGGCTAGG - Intronic
1134515229 16:14881753-14881775 GGCCCCAAGACTGCTAGGAGTGG + Intronic
1134702902 16:16280398-16280420 GGCCCCAAGACTGCTAGGAGTGG + Intronic
1134964641 16:18431717-18431739 GGCCCCAAGACTGCTAGGAGTGG - Intronic
1134968928 16:18514252-18514274 GGCCCCAAGACTGCTAGGAGTGG - Intronic
1138277229 16:55743860-55743882 TGACCCAAGGCTGTGTGGGTGGG + Intergenic
1138283118 16:55787038-55787060 TGACCCAAGGCTGTGTGGGTGGG + Intergenic
1138285813 16:55809563-55809585 TGACCCAAGGCTGTGTGGGTGGG - Intronic
1139196411 16:64923909-64923931 AAACCCAGGAATGTTAGGGTTGG - Intergenic
1145269953 17:21399552-21399574 GGACCCAGGAGTGGTGGGGTAGG - Intronic
1148479128 17:47948703-47948725 GGATCATAGACTGTGAGGGTGGG - Intergenic
1149261988 17:54890291-54890313 AGACCCAGGCCTGTTAGTGTAGG - Intergenic
1151361426 17:73591514-73591536 AGACCCAAGGCTGTTAGAGTTGG + Intronic
1159765399 18:72482081-72482103 GGACCTGGGCCTGTTAGGGTAGG - Intergenic
1160554816 18:79718167-79718189 GGACCCAAGACTGCAAGCGGGGG - Intronic
1162441143 19:10692876-10692898 GGACCCAAGAGTGTTAGGAAGGG + Intergenic
1166498776 19:43326032-43326054 GGACAAAAGAGTGTTCGGGTTGG + Intergenic
1167300283 19:48673905-48673927 GGTCCCAAGCCTGTCAGGATTGG - Intergenic
927654719 2:24935481-24935503 GCAGCCAAGGCTGTGAGGGTAGG + Intergenic
932159289 2:69446178-69446200 GGACAAAAGAGTGTAAGGGTTGG + Intergenic
932572377 2:72944905-72944927 GGGCCCAGGACTGCTGGGGTTGG + Exonic
932575616 2:72960907-72960929 GGAGCCAGGAGCGTTAGGGTGGG - Intronic
935232422 2:101110442-101110464 GGGCCCAAAGCTGTTAGGGAAGG - Intronic
935609031 2:105001536-105001558 GGACCTAAGACTATCAGGGCAGG - Intergenic
935710797 2:105896474-105896496 GGCCCTAAGACTGCTAGGGAAGG - Intergenic
942064771 2:172260401-172260423 GGACTCAAGACGTTTAGGGAAGG - Intergenic
943355539 2:186850377-186850399 AGACCTAAGACTTTAAGGGTTGG - Intergenic
947632539 2:231663387-231663409 GGGCCCAGGACTGTTTGGGGAGG + Intergenic
1169336711 20:4762789-4762811 GGTCCCAAGGCTGATCGGGTTGG - Intergenic
1173567879 20:44054828-44054850 GGACTCCAGACTTTTAGGGTTGG - Intronic
1174830827 20:53810820-53810842 TGACCCAAGAATTCTAGGGTTGG - Intergenic
1175092684 20:56518052-56518074 AGAGCCAAAACTGTCAGGGTTGG - Intronic
952738613 3:36714251-36714273 GGCTCCAAAACTGTTAGGGAAGG + Exonic
953363776 3:42324339-42324361 GGATCCAAGACTGTTAGTCAAGG + Intergenic
961065418 3:123870982-123871004 GGGTCCTAGACTGTCAGGGTGGG + Intronic
961455093 3:127020124-127020146 GGCCCCAAGAGTGGGAGGGTTGG + Intronic
962057638 3:131888909-131888931 GGACCCAAGAATACTTGGGTTGG + Intronic
962755383 3:138461981-138462003 GGAGCCCAGATTGGTAGGGTGGG - Intronic
963761200 3:149288697-149288719 GCACCTGAGACTGTTGGGGTGGG - Intergenic
969104259 4:4793251-4793273 GAACCACAGACTGTCAGGGTAGG - Intergenic
983287714 4:165760613-165760635 ATACCCAAGACTGGTAGGGATGG + Intergenic
984674195 4:182528053-182528075 GAACACAAGAATATTAGGGTTGG - Intronic
988868032 5:35356751-35356773 GAATCCATGACTGTGAGGGTAGG - Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998544577 5:143015706-143015728 GGACCCAAGAGTGGTGGGGTGGG + Intronic
1000045370 5:157517925-157517947 GAATCCCAGACTGTCAGGGTGGG - Intronic
1002663054 5:180803817-180803839 GGACCCCAGGCGGTGAGGGTGGG + Intronic
1004108685 6:12692263-12692285 GGAACCAAGACTGTTTTGATAGG + Intergenic
1006868159 6:37225927-37225949 TGACCCACGGCTGATAGGGTAGG - Intronic
1007254672 6:40520486-40520508 GGACCCAAGTCTGCAAGGGAGGG - Intronic
1007391084 6:41549689-41549711 GGACCTCAGATTGTTGGGGTAGG + Intronic
1011262056 6:85480175-85480197 GTACCCAAGCCTGATAGGCTGGG - Intronic
1011366440 6:86587293-86587315 GGACCCAAGACTCTCTGGCTGGG - Intergenic
1014115192 6:117662246-117662268 GGACAAAAGAGTGTAAGGGTTGG + Intergenic
1018034284 6:159868013-159868035 AGACCCCACATTGTTAGGGTTGG - Intergenic
1019158544 6:170054504-170054526 GAACCCAAGTCTGCGAGGGTAGG + Intergenic
1020256063 7:6503740-6503762 GGACCCAAGACGGAGAGGGCAGG + Intronic
1032984592 7:137323786-137323808 GTACCCCAGACTCTGAGGGTAGG - Intronic
1034927444 7:155133547-155133569 GGACCCCAGACTGTCGGGGCAGG - Intergenic
1039613022 8:38933963-38933985 GAACCCAAGAATCTTAGAGTGGG - Intronic
1040088040 8:43365745-43365767 GGAGGCAAGACAGCTAGGGTGGG - Intergenic
1041215152 8:55593120-55593142 AGAATCAAGACTGTTAGAGTTGG - Intergenic
1045980786 8:108184877-108184899 GAAAACAAGGCTGTTAGGGTGGG + Intergenic
1047978330 8:130153788-130153810 GGACCCAAACCTGTTGGGGGTGG + Intronic
1054783080 9:69184157-69184179 TGAACCATGACTGATAGGGTAGG - Intronic
1058576622 9:106410472-106410494 GGACCTAAGACTTTTAGCATAGG + Intergenic
1062445734 9:136593440-136593462 GGACCCCAGGCTGTGATGGTGGG - Intergenic
1187969838 X:24648068-24648090 GGACCCACGACTGGTAAAGTAGG - Intronic
1189130256 X:38491005-38491027 GGAAGCAAACCTGTTAGGGTGGG - Intronic
1193886081 X:86984982-86985004 GGACAAAAGAGTGTAAGGGTTGG - Intergenic
1198045104 X:132893712-132893734 GAAGCCAAGACAGATAGGGTTGG + Intronic
1198825516 X:140694578-140694600 GGACTCTAGACTGTTAAGGCAGG - Intergenic