ID: 1132474762

View in Genome Browser
Species Human (GRCh38)
Location 16:128914-128936
Sequence AAGGGTATGAACCCTGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132474756_1132474762 -1 Left 1132474756 16:128892-128914 CCAGGAGGGGAACTGAGCCCCTA 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1132474762 16:128914-128936 AAGGGTATGAACCCTGTATCTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1132474751_1132474762 17 Left 1132474751 16:128874-128896 CCTACGTGACAAAATAAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1132474762 16:128914-128936 AAGGGTATGAACCCTGTATCTGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132474762 Original CRISPR AAGGGTATGAACCCTGTATC TGG Intronic
901535438 1:9879783-9879805 AAGGGTCTGAGCCCTGTAGACGG - Intronic
904234378 1:29105091-29105113 AAGGCTATGAAGCCAGTTTCAGG - Intronic
904705675 1:32388778-32388800 AAGAGTTAGAACTCTGTATCAGG - Intronic
905082056 1:35331967-35331989 ATGGGTCAGAACCCTGTATTTGG - Intronic
912490271 1:110058989-110059011 ACAGGTGTGAGCCCTGTATCCGG - Intronic
1064175349 10:13070522-13070544 CAGGTTAGGAACCCTGTATGGGG - Intronic
1064731720 10:18338167-18338189 TGGGGTATTAACCCCGTATCAGG - Intronic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1075537626 10:123284068-123284090 AAGGGTATTAACCCTTTCTTGGG + Intergenic
1076341517 10:129750285-129750307 AAAGGTATAAAGTCTGTATCTGG + Intronic
1078125888 11:8563124-8563146 ATGAGTAAGTACCCTGTATCTGG + Intronic
1079499984 11:21092287-21092309 AAGGGTCAGCACCCTGTAGCTGG + Intronic
1080243510 11:30154275-30154297 AGGGGTATGAACTCTGTAGGTGG - Intergenic
1084617645 11:70247049-70247071 AAGGGAAGGGACCCTGTATTAGG + Intergenic
1084917190 11:72437657-72437679 GAGGGTTTGAACTCTGCATCTGG - Intergenic
1087922150 11:103878610-103878632 AATGCTATGAACCCTTTGTCAGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1091080526 11:132663005-132663027 AAAGGTATGCACCCTGTTTTAGG - Intronic
1091634848 12:2189239-2189261 AAGGGGAGAAATCCTGTATCAGG - Intronic
1091770832 12:3150223-3150245 AAGGGTATTAAGCCTATAACTGG - Intronic
1092501576 12:9052674-9052696 AAGGGTATGGACTCTGGAGCTGG + Intergenic
1094384063 12:29874300-29874322 AAGAGTTTTAACCCTTTATCTGG - Intergenic
1095428475 12:42106553-42106575 AAGAGTATGGACTCTGAATCTGG - Intronic
1099926809 12:89028288-89028310 ATGGGAAGGAAACCTGTATCAGG - Intergenic
1102005929 12:109589199-109589221 ATGGGTATGAGCCCTGGATCTGG + Intronic
1117869395 14:60184177-60184199 AAGGGAATTTACCCTCTATCTGG + Intergenic
1118535543 14:66759286-66759308 CAGGTTAGGAACCCTGTATAGGG + Intronic
1118999301 14:70866776-70866798 CAGGGTAGGAACCCTGTACAGGG + Intergenic
1119328172 14:73774654-73774676 GGGGGTATAAAACCTGTATCGGG - Intronic
1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG + Intergenic
1125931611 15:43604254-43604276 AAGGATATGAAGCCTAGATCTGG - Intronic
1125944715 15:43703734-43703756 AAGGATATGAAGCCTAGATCTGG - Intergenic
1131729755 15:95267466-95267488 AGGGATATGGATCCTGTATCAGG - Intergenic
1132342483 15:101087197-101087219 AAGTGAATGAACTCTTTATCTGG + Intergenic
1132474762 16:128914-128936 AAGGGTATGAACCCTGTATCTGG + Intronic
1132502883 16:292448-292470 AAGGGTCTGAACCCTGATGCTGG + Intronic
1135172394 16:20197316-20197338 AAGTTTATGAACCCTCTAACAGG - Intergenic
1135535642 16:23292278-23292300 AATGGCATGAACCCTGTAGGCGG - Intronic
1137546032 16:49404263-49404285 AAGCGAATGTACCCTGTCTCTGG - Intergenic
1142877374 17:2860020-2860042 TAGGGTGTGAACCTGGTATCGGG + Intronic
1149311334 17:55396984-55397006 AAGGGTCTTAACCTTGTATAGGG - Intronic
1159014278 18:63088757-63088779 AAGGGAAGAAACCCCGTATCTGG + Intergenic
1161482887 19:4519542-4519564 AGGGCTAGGAACCCTGTCTCAGG - Intergenic
1163486945 19:17593550-17593572 AATGGCATGAACCCAGTGTCAGG + Intergenic
1164455020 19:28399690-28399712 AATGGAATGAGCCCTGCATCTGG - Intergenic
1164981879 19:32620171-32620193 AAGGGTTAGATCCCTGTTTCTGG - Intronic
1165327576 19:35123195-35123217 CAGGCTAAGAACCCTCTATCCGG + Intronic
927764807 2:25796905-25796927 AAGCGTGTGAGACCTGTATCTGG - Intronic
931790153 2:65657794-65657816 AAAGTTATGAATACTGTATCAGG + Intergenic
939568762 2:143815314-143815336 AAGGTTATGAACCCTGCACTGGG + Intergenic
942063827 2:172251915-172251937 CAGTGTATGAACACGGTATCCGG + Intergenic
942449788 2:176101580-176101602 AGGCCTATGAACCCTGTAACTGG + Intergenic
947363241 2:229367255-229367277 AAGGATATTAACCCTGGGTCTGG - Intronic
947407781 2:229798700-229798722 CAGTTTATGAACCCTGCATCTGG - Intronic
1172686846 20:36762191-36762213 AATGGCATGAACCCGGTATGCGG - Intronic
1174460223 20:50677268-50677290 ATGGGTTTGGACCCTGTGTCTGG - Intronic
1179956619 21:44743996-44744018 CAGGTTAGGAACCCTGTATGGGG - Intergenic
1183203830 22:36404769-36404791 AAGGGTATGCATCCTGGGTCTGG + Intergenic
949336753 3:2983125-2983147 AATGGTATGAACCCTGGAGGTGG + Intronic
950166574 3:10805199-10805221 AAGGGCAGGATCCCTGTATTTGG + Intergenic
951255924 3:20449090-20449112 CAGGTTAGGAACCCTGTATGGGG + Intergenic
954187952 3:48933634-48933656 AATGGTATGAACCCGGTAGGCGG - Intronic
958945078 3:100353718-100353740 AAGGGTTTGAACCCTTGCTCTGG + Intronic
960562862 3:119104632-119104654 AAGGTTATGAAACTTGTATAAGG + Intronic
961473007 3:127129264-127129286 AAGGATATTAACCCTTTACCTGG + Intergenic
962041025 3:131707613-131707635 AAGGGAATGAACTCTGGAACTGG - Intronic
963251556 3:143108816-143108838 CAGGTTAGGAACCCTGTATAGGG - Intergenic
964287092 3:155129975-155129997 AAGAGTCTGAACTCTGTATTGGG + Intronic
965767773 3:172149357-172149379 AAGGAATTGAAACCTGTATCTGG - Intronic
966654197 3:182335322-182335344 ATGGGAATGAACTCTGCATCTGG - Intergenic
969429553 4:7146195-7146217 GAGAGTGTGAACCCTGTGTCGGG + Intergenic
972575167 4:40344688-40344710 AAGGTTATGAAACTTGAATCAGG + Intronic
977876490 4:102156185-102156207 AATGGTATGAACCCAGGAGCCGG - Intergenic
982028558 4:151276784-151276806 GAGGAAATGAACCCAGTATCTGG - Intronic
982689874 4:158536040-158536062 AATGGAATGAACCCATTATCTGG + Intronic
983694868 4:170515669-170515691 CAGGCCATGAACCCTGTATAGGG + Intergenic
984327666 4:178274388-178274410 CAGGTTAAGAACCCTGTATGGGG - Intergenic
985828389 5:2209722-2209744 AAGGGTATTATTCCTGTATGGGG - Intergenic
986104652 5:4648454-4648476 AAGGGTGTGAACTCTGGAACAGG - Intergenic
988157618 5:27475671-27475693 CAGGTTAAGAACCCTGTATGTGG - Intergenic
992578667 5:78148162-78148184 CAGTGTATGAGGCCTGTATCTGG - Intronic
994157682 5:96522027-96522049 AATGGTATGAACCCTGGAGGTGG + Intergenic
994654971 5:102581237-102581259 AAGGGAATGTATCCTGAATCAGG + Intergenic
995661950 5:114494797-114494819 AAGTGTATGCACTCTGTCTCTGG + Intronic
996791264 5:127295791-127295813 AAGGGTGTGTACCCAGTATCTGG + Intronic
999402049 5:151272794-151272816 AAAGATATGAACCTTGTATTAGG + Intergenic
1001425980 5:171622987-171623009 GAGGGTATGAAACCTGGACCTGG - Intergenic
1001457966 5:171881064-171881086 AAGTATATTAACCTTGTATCCGG + Intronic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1009032668 6:58079135-58079157 AATGGTATGAACCCTGGAGGTGG + Intergenic
1009632054 6:66212814-66212836 CAGGTTAGGAACCCTGTATGGGG - Intergenic
1011247700 6:85336938-85336960 TAGGGTATGAGACATGTATCAGG + Intergenic
1012522914 6:100142237-100142259 AAGGGTATTAACCCTGTGTCTGG - Intergenic
1013280826 6:108635395-108635417 AAGGGTATTTCACCTGTATCTGG + Intronic
1014467204 6:121771347-121771369 AGGGGGATGAAGACTGTATCTGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1019908962 7:4086714-4086736 AAGGGTAAGAACCTTACATCAGG - Intronic
1021564448 7:22003116-22003138 AAGGGTATGGACCTGGTGTCTGG + Intergenic
1022232293 7:28425977-28425999 AAGGGCATGAAGCCTCAATCTGG - Intronic
1023330107 7:39106255-39106277 AATGGTATCAACTCTGTATTAGG - Intronic
1024642315 7:51340255-51340277 TAGGGTATCAGCCCTGTACCAGG - Intergenic
1024912937 7:54466792-54466814 AAGGGGATGAACCCAGTCTCTGG + Intergenic
1025634649 7:63311901-63311923 CAGGTTAGGAACCCTGTATAGGG - Intergenic
1025648047 7:63436269-63436291 CAGGTTAGGAACCCTGTATAGGG + Intergenic
1028363179 7:89993794-89993816 AAGAGTATGAACCCTTTCCCAGG + Intergenic
1034315333 7:150125799-150125821 AAGGGTTCGAATCCTGTTTCAGG - Intergenic
1034720069 7:153283970-153283992 AGGAGTAAGAACCCTGTATTAGG - Intergenic
1045816039 8:106277612-106277634 ATGGGTGTGAGCCCTGAATCAGG - Intronic
1046177478 8:110596869-110596891 AACCGTATAAACCCAGTATCTGG - Intergenic
1048464555 8:134654771-134654793 AAGGGGCTGTACCCTGTGTCAGG + Intronic
1053075740 9:35132875-35132897 CAGGTTAGGAACCCTGTATAGGG - Intergenic
1053447946 9:38167411-38167433 AAGGGTATGGACCCTGGAGCTGG - Intergenic
1054895475 9:70305772-70305794 AAGAATGAGAACCCTGTATCTGG + Intronic
1059038560 9:110787273-110787295 AATGGTGTGAACCCAGTATGTGG + Intronic
1189339095 X:40190996-40191018 CAGTGTTTGAACCCTGTATTGGG + Intergenic
1190277847 X:48910774-48910796 CAGGGACTGAATCCTGTATCAGG + Intronic
1191167587 X:57406577-57406599 AAGGTTATGATCCCTGTGTCAGG - Intronic
1195337198 X:103867120-103867142 CAGGTTAGGAACCCTGTATGGGG + Intergenic