ID: 1132475414

View in Genome Browser
Species Human (GRCh38)
Location 16:133974-133996
Sequence TCTTATGTGGACATGGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 8, 3: 77, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132475411_1132475414 11 Left 1132475411 16:133940-133962 CCAGAATACACACAATTATTGAT 0: 1
1: 0
2: 1
3: 25
4: 238
Right 1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG 0: 1
1: 0
2: 8
3: 77
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132475414 Original CRISPR TCTTATGTGGACATGGTTCT TGG Intronic
900832952 1:4978191-4978213 TATCATGTGGAGATGATTCTGGG - Intergenic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909650377 1:77969074-77969096 TTTTATGTGTAGATGGCTCTTGG - Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910918322 1:92315305-92315327 TTTTATGTGGGCTTGGTTCATGG + Intronic
910997033 1:93116940-93116962 TCTTAGGTGGGCACGGTTTTTGG + Intronic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912660228 1:111521262-111521284 TCTTGTGAGGACATGTTTTTGGG + Intronic
914695339 1:150073024-150073046 TCTTATGTGCACAACTTTCTTGG + Intronic
914723167 1:150306041-150306063 TCTGATGTGCAGATGATTCTGGG + Intronic
916784385 1:168074350-168074372 TACTATGTGGAAATGTTTCTGGG + Intronic
916839923 1:168589108-168589130 TTTAATGTGGACATGTTTCAAGG - Intergenic
917552327 1:176045901-176045923 TCTTTGTTGGACATGGTTGTTGG - Intronic
918299243 1:183187246-183187268 ACTTGTGTGGAAATGGCTCTTGG - Intronic
918386200 1:184010645-184010667 TGTTCTTTGGTCATGGTTCTAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
918881912 1:190135291-190135313 TCTTTTATGGAAATGTTTCTGGG + Intronic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
1063558668 10:7105750-7105772 TCTTCTGTGGGCATGGGGCTGGG - Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064460905 10:15534446-15534468 TCTCCTGTGCACATTGTTCTAGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065666656 10:28070444-28070466 TCTTAGGTAGACATGTTTTTAGG - Intronic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1070049551 10:72874166-72874188 TCAAATGTGTACATGGTTCAGGG + Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074084680 10:110200161-110200183 TCTTTTGTGGGTGTGGTTCTTGG + Intergenic
1074855274 10:117468757-117468779 TATTTGGTGGACATTGTTCTGGG + Intergenic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1078289872 11:9998286-9998308 TCTGATGTAGAAGTGGTTCTGGG + Exonic
1078524720 11:12091617-12091639 TCTGAAGGGGACATGGTTCTTGG - Intergenic
1079252834 11:18799837-18799859 TCTTTTCTGGACATTGGTCTGGG - Intergenic
1079540097 11:21562919-21562941 TCATCTGTGGACATGTTTCAAGG - Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1083164264 11:60873859-60873881 ACTTATATGGACAAAGTTCTGGG + Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1086734262 11:90286156-90286178 TCTTTTATGGACATAGTTCGTGG + Intergenic
1087030494 11:93699160-93699182 TGTTAATTGAACATGGTTCTTGG - Exonic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1091025369 11:132136560-132136582 TCATATGTGTACATGGTCCCTGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1092727441 12:11499613-11499635 TCATGTATGGACAGGGTTCTTGG + Intronic
1093149911 12:15608294-15608316 TCTTGTCAGGGCATGGTTCTAGG - Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1095865438 12:46966603-46966625 TCATATGTCGAAATGGTCCTTGG + Intergenic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1099308421 12:80987566-80987588 CCTTTTGTGGACATGCTTGTTGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101406917 12:104436865-104436887 TTATATGTGGGCATGCTTCTGGG + Intergenic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104766608 12:131333923-131333945 TATTCTGTGGCCATGATTCTGGG + Intergenic
1104812812 12:131628742-131628764 TATTCTGTGGCCATGGTTCTGGG - Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107430600 13:40336931-40336953 TTAAATGTTGACATGGTTCTTGG - Intergenic
1108028342 13:46201947-46201969 TCTTTAGTGGAAATGCTTCTGGG + Intronic
1109408662 13:61936024-61936046 TCATATGTTGTCATGCTTCTGGG + Intergenic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1112015881 13:95331085-95331107 TCTTGTGTGTGCATGGTTATGGG - Intergenic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115726391 14:36221777-36221799 TCTTCTGTTAACATGTTTCTGGG + Intergenic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117884366 14:60344159-60344181 GCTTATGTGGACGTGGAACTCGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122669230 14:103357502-103357524 TTTTATGGGGAGATGGATCTGGG - Intergenic
1122993873 14:105252071-105252093 TCTTGTGTGGACAAGGTTTAAGG - Intronic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1127600383 15:60529979-60530001 TCTTAAATGGACAGGGTTCTAGG - Intronic
1128344758 15:66846532-66846554 TATTATCTGGGCATGGTGCTGGG - Intergenic
1128969476 15:72094894-72094916 TCTTATATGGTCATGATTTTTGG - Intronic
1129018114 15:72487467-72487489 TCTAATGTGGACATTTATCTTGG + Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130875222 15:88007945-88007967 TCTTCTGTGCCCATGATTCTAGG - Intronic
1130972326 15:88742485-88742507 TCTGTTGTGGCCATGGGTCTTGG - Intergenic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139629161 16:68217616-68217638 TCCTATGTGGAAATGTCTCTGGG - Intronic
1141349636 16:83282168-83282190 TCTTCTGCGGACATGGCTCATGG + Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142195628 16:88738097-88738119 TCTTCTCTGGACAGGGTGCTGGG - Exonic
1142550937 17:739070-739092 TTTTATGGGGAAATGGATCTGGG - Intronic
1142793095 17:2283954-2283976 CCTTATGAGTACTTGGTTCTTGG - Intronic
1144895738 17:18530518-18530540 TCTTATGTGAACATAGTTTGAGG - Intergenic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1151317963 17:73335472-73335494 TCTAATGTGGCCAGGTTTCTGGG + Exonic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154337707 18:13478950-13478972 TTTTATGTGGATCTGCTTCTGGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1156881020 18:42079356-42079378 TCTTATGCAGACACGGTTCGTGG + Intronic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1161537144 19:4826865-4826887 GCTTATGTGGACCTGGTTATGGG + Intronic
1162018337 19:7857425-7857447 CCTTATGTGAATATGGTTTTAGG - Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1168498547 19:56874509-56874531 TCTTATGTTGAGTTGGTTCTGGG - Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
926449973 2:12991131-12991153 TTTTATATGGACATGCTTCCTGG - Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
932344003 2:70984069-70984091 CCTGATGTGGACACGCTTCTTGG - Intronic
933060256 2:77727614-77727636 ACTTTTGTGGAGATGGTTTTTGG + Intergenic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936475047 2:112832410-112832432 ACTTGGGTGGACATGGTCCTGGG + Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
937691267 2:124757995-124758017 TATTATGTAAACATGTTTCTTGG + Intronic
939080453 2:137654572-137654594 TTTTCTGTGCACTTGGTTCTGGG + Intronic
939270878 2:139937827-139937849 TCTGTTGAGGACATGGATCTGGG - Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940037474 2:149325967-149325989 TCTTATCTGGACACGGTCCATGG + Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940990802 2:160094375-160094397 TCTTTTGTCGACAATGTTCTTGG - Intergenic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
943878539 2:193107300-193107322 TCTTATTTGGATATAGTCCTAGG + Intergenic
944079611 2:195772004-195772026 TCTTGTGTGGAGATGGATCATGG - Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
946039297 2:216770040-216770062 TCTTAGGGGGTGATGGTTCTGGG + Intergenic
946271310 2:218596587-218596609 TCTTTTGTGAACATGTTTTTTGG + Exonic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947092352 2:226526358-226526380 TCTTATCTGGAAAGGCTTCTGGG - Intergenic
947282317 2:228469310-228469332 TCATATGTTGGCATGCTTCTGGG + Intergenic
947747149 2:232514128-232514150 TCTGATGTAGAGATGGTTCTTGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169750797 20:8991349-8991371 TCTTTTATGGGCATGGGTCTTGG + Intergenic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1173713998 20:45185910-45185932 TCATATGTGGACATCCTCCTGGG - Intergenic
1174568619 20:51485129-51485151 TCAAATGTGGACATGGTAATTGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1174991396 20:55514302-55514324 TCTTCTGTGAACATGGTTTGTGG + Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179429190 21:41307762-41307784 TCTTCTGTGGACACTGTTCATGG + Intronic
1179538918 21:42071522-42071544 TCTTTTGTGGACAAGCTTTTTGG + Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1184825400 22:46947241-46947263 TGTTGTTTGGACATGGTTCTTGG + Intronic
1185177995 22:49341185-49341207 TCTTATGTGGTCATAGTACATGG - Intergenic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
949625952 3:5866964-5866986 TCTTCTGTTGGCATTGTTCTTGG - Intergenic
950415547 3:12867139-12867161 TTCTATGCAGACATGGTTCTGGG - Intronic
951042969 3:18008527-18008549 TCTTATGTGGACACAGCTCATGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
954493849 3:50933959-50933981 TCTTTTGTGGCTCTGGTTCTAGG + Exonic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955925074 3:63996404-63996426 TTTCATGTGGACATTGTTCACGG - Exonic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956406827 3:68936640-68936662 TCTTACGTGGACATGTTGCATGG - Intergenic
959492471 3:107007115-107007137 TCTGGTGAGGACATGATTCTTGG + Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960439187 3:117665894-117665916 TCTTATATTTATATGGTTCTAGG + Intergenic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964153882 3:153562051-153562073 TCTCAAGTGTACATGGTTGTTGG + Intergenic
964323025 3:155517609-155517631 TCTTATGAGGACATTGTCATTGG + Intronic
964452833 3:156828048-156828070 GCTTATGTTGACATGGTTAATGG + Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965464046 3:169004816-169004838 TTTTTTGTGCACCTGGTTCTAGG - Intergenic
966736061 3:183188110-183188132 TCTTATCAGGCTATGGTTCTTGG - Intronic
966928393 3:184660121-184660143 TCCTATGTGGAGCTGGGTCTAGG - Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968960927 4:3743318-3743340 ACTTATCTGCACATGGTCCTGGG - Intergenic
970394615 4:15654375-15654397 ACTTTTGTGGAGATGGTTCAGGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970724146 4:19023959-19023981 TCTTATGTGGCTGTGGTTCGCGG - Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971830828 4:31692530-31692552 TTTTATGTGGGCATAGTTTTTGG - Intergenic
972003431 4:34067951-34067973 TCATATGTTGACATACTTCTGGG - Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973589416 4:52425587-52425609 TCTTATTTGGACCTGGTGGTGGG - Intergenic
973737749 4:53889176-53889198 CCTTATGTGGACATGGGACATGG - Intronic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
976513102 4:85933039-85933061 TCTTAAGTTGGCATGGTTTTAGG - Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977216639 4:94292864-94292886 TTTTATGTGGACATGTTTTCAGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979950040 4:126880873-126880895 TTTGATGTAGACATGTTTCTTGG + Intergenic
979973817 4:127170791-127170813 TCTTATGTGGACACAATTCATGG - Intergenic
979978571 4:127226537-127226559 GCTTTTGTGGACATTGTTTTTGG + Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981437560 4:144744100-144744122 TCTTATTACTACATGGTTCTTGG - Exonic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
982889969 4:160835121-160835143 TGTTACGTGGACATTGTCCTGGG + Intergenic
983124686 4:163936145-163936167 TCTTATGTAGGCATGATTCCGGG + Intronic
983154767 4:164333530-164333552 TCTTATGTGGGCACAGTTCATGG - Intronic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
983769423 4:171530565-171530587 TCTTATGTGAATTTGGTTCCTGG + Intergenic
983830605 4:172322141-172322163 TCATATGTTGGCATGTTTCTAGG - Intronic
984104711 4:175530900-175530922 TCTTACGTGGGCACAGTTCTTGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984461079 4:180037612-180037634 TCTTATATGGTCACAGTTCTTGG - Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986486822 5:8246091-8246113 TCTTCTGTGGAAATTGTGCTTGG - Intergenic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
988038490 5:25858549-25858571 TTTTATGTTAATATGGTTCTTGG + Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990975197 5:61554346-61554368 ACTTTTGTGGACATTGGTCTAGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991936248 5:71803708-71803730 TCTTATAGGAACGTGGTTCTTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
1000131889 5:158308074-158308096 TCTTATAATGAAATGGTTCTTGG + Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1001775496 5:174326382-174326404 TTTTGTGAGGACATGGTGCTGGG + Intergenic
1003337012 6:5183184-5183206 GCTTATGGGGACATGGTTGGAGG + Intronic
1003875539 6:10433253-10433275 TCTTTTGTTTTCATGGTTCTAGG - Intergenic
1004214484 6:13688966-13688988 TTTTTTGTGGAGATGGGTCTCGG - Intronic
1004613079 6:17264578-17264600 GCTTGTCTGGACATGGTTTTAGG - Intergenic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1009415511 6:63411942-63411964 TCTTATGTAGAAATATTTCTGGG + Intergenic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009740485 6:67737243-67737265 TGTCATGTGGACATGGGCCTTGG - Intergenic
1010916003 6:81619754-81619776 TTTTATGTGGACATTTTTCTTGG + Intronic
1012044774 6:94258852-94258874 TATTATATGGAAATGGCTCTTGG + Intergenic
1012084144 6:94802030-94802052 TCTCATATGGACACAGTTCTTGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1014175276 6:118325349-118325371 TCTTATCTGCACCTCGTTCTGGG + Intergenic
1014262435 6:119235006-119235028 TTTTATGTGGACGTGGTTGGTGG - Intronic
1014510772 6:122319301-122319323 TCTTTTGTGGACATAATTGTGGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015575197 6:134663940-134663962 TTTTATGTTGACATGTTTGTGGG + Intergenic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016957834 6:149643618-149643640 ACATTTGAGGACATGGTTCTAGG - Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017507253 6:155079983-155080005 TCTTATGTGGATTTGCTGCTTGG + Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1019516767 7:1443600-1443622 TCTTCTAAGGACATGGTTGTTGG - Intronic
1020121289 7:5505181-5505203 ATGTATGTGGACATGGTTCTGGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1022186804 7:27977387-27977409 TCTTATGTGGGTTTGGTTTTAGG + Intronic
1022340628 7:29464069-29464091 TCTTATGTGTGCATTGTTCAGGG + Intronic
1023373858 7:39537081-39537103 TCTTTTGTGGTTATGATTCTGGG - Intergenic
1023451752 7:40293723-40293745 TCTTATGTAGAGAGGCTTCTTGG + Intronic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1027224525 7:76235454-76235476 TCTTGTCTGGACAAGGCTCTTGG - Intronic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1028300091 7:89188285-89188307 TTCTATATGAACATGGTTCTTGG - Intronic
1028406391 7:90479287-90479309 TCTTATGAGGAAGTTGTTCTGGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029412218 7:100421202-100421224 TCTAGGCTGGACATGGTTCTAGG - Intronic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1032379050 7:131456730-131456752 TCATATATGGACATGATTCTTGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1034741588 7:153478871-153478893 TGTTCTGTGGACCTGCTTCTGGG - Intergenic
1034796841 7:154021515-154021537 TTTTATGTGAAAATGGTTGTAGG - Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1038427988 8:27477504-27477526 TCTTATTTGCACATTCTTCTGGG - Intronic
1038874993 8:31538706-31538728 TCTCATGGGAACATGGTGCTTGG + Intergenic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040052425 8:43030029-43030051 TCTGATGTGGACATTGTTTTTGG - Exonic
1042154198 8:65824271-65824293 TGTTATGTGGACAAGTTTCATGG - Intronic
1042411403 8:68470694-68470716 TCTGATGAGGACCTGTTTCTTGG + Intronic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043173144 8:76990669-76990691 TCTTATATGGATACAGTTCTTGG + Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044080874 8:87881798-87881820 AATAATGTAGACATGGTTCTTGG + Intergenic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1046400624 8:113699166-113699188 TTATATATTGACATGGTTCTGGG + Intergenic
1047704346 8:127482656-127482678 TCTTATGTGAAAATCTTTCTGGG - Intergenic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1049802881 8:144526408-144526430 TCTCAAGTGGAGAAGGTTCTTGG + Exonic
1050522315 9:6513828-6513850 TTTTGTGTGGACATAATTCTAGG + Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1050706591 9:8406283-8406305 TTCTGTGTGGACATGGTTCAAGG - Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055679386 9:78699321-78699343 TCTTTTGTGGTCATAGTTTTGGG - Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056701844 9:88917709-88917731 TCGTATGGGAAGATGGTTCTGGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057323356 9:94035059-94035081 TCTTAGGTGGAAAAGATTCTAGG + Intronic
1057323527 9:94037169-94037191 TCTTAGGTGGAAAAGATTCTAGG + Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058260871 9:102829716-102829738 TGTTATGTGGGCATGGCTCATGG - Intergenic
1058331929 9:103772708-103772730 ACTTATGTGGACATTGGTATAGG - Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059203727 9:112443985-112444007 GCTTATGTGGAGATGGCTATAGG - Intronic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1062140911 9:134958472-134958494 TCTTCTGTGGACAAGAGTCTGGG + Intergenic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187811152 X:23178977-23178999 TATTATGTGTACATGGTGCACGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188432648 X:30122507-30122529 TCTTATGTAGGCATAGTTCATGG - Intergenic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189263715 X:39697294-39697316 TCTTATGTGGTCACAGTTCATGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193546323 X:82834864-82834886 TAATATGTGGACTTGTTTCTGGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1197367633 X:125583563-125583585 TCTTATGGGGACATTGTGATTGG - Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1198673118 X:139102947-139102969 TCTTATATTTACATGGATCTAGG - Intronic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1200736515 Y:6804405-6804427 TCTTATGAGAACCTGGCTCTAGG - Intergenic
1200817444 Y:7548292-7548314 TCTGGTGAGGACTTGGTTCTTGG + Intergenic