ID: 1132478273

View in Genome Browser
Species Human (GRCh38)
Location 16:153333-153355
Sequence TCTGACAAGCAGAGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132478268_1132478273 0 Complete closest: 0
total_pairs: 2
max_distance: 1000
Left 1132478268 16:153310-153332 CCTGGGCAGGCACAGGCCCAGGT 0: 2
1: 0
2: 10
3: 79
4: 568
Right 1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG 0: 2
1: 0
2: 0
3: 19
4: 236
1132478262_1132478273 19 Complete closest: 19
total_pairs: 3
max_distance: 1000
Left 1132478262 16:153291-153313 CCATCTGGGCTCGCTGAGACCTG 0: 2
1: 0
2: 3
3: 42
4: 897
Right 1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG 0: 2
1: 0
2: 0
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132478273 Original CRISPR TCTGACAAGCAGAGGGTGAA AGG Intronic
900347088 1:2215085-2215107 CCTGACAAGGAGGGGGTGACCGG + Intergenic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
903126885 1:21254465-21254487 TCTTCCAAGCAGAGGAAGAAAGG - Intronic
903304644 1:22404217-22404239 GCTGGAAAGCTGAGGGTGAAGGG + Intergenic
906442870 1:45865118-45865140 TCTGAGAAGGAGAGGGTTACAGG + Intronic
910339543 1:86170007-86170029 AATGAAAAGAAGAGGGTGAATGG + Intergenic
911184457 1:94889146-94889168 ACTAACAAGCATAGGGTTAAGGG - Intronic
911379424 1:97093894-97093916 TTTGGCAAGCAGAGAGGGAAAGG - Intronic
912624748 1:111197711-111197733 CCTGACCAGCAGCGGGAGAAGGG + Intronic
913331070 1:117668283-117668305 TCTGGCAAGCAGATGGCCAAGGG + Intergenic
915470501 1:156123082-156123104 TCAGAAAAGCAGAGGCTGAGGGG + Intronic
917983312 1:180288503-180288525 ACTCACAGGCAGAGGCTGAAAGG + Exonic
918611363 1:186496123-186496145 ACTGGCAAGGAGAAGGTGAAAGG + Intergenic
920534393 1:206728375-206728397 ACTGGGAAGCAGGGGGTGAAGGG - Intronic
920623966 1:207577905-207577927 TCTTGGAAGCAGAGGGAGAAAGG + Exonic
920636605 1:207710482-207710504 TCTTGGAAGCAGAGGGAGAAAGG + Intronic
921667985 1:217895308-217895330 TCTGAGAAACAGAGAGTGATAGG - Intergenic
921687275 1:218104440-218104462 TCTGACTAGAAGAGGAAGAATGG - Intergenic
922030179 1:221790253-221790275 CCTGACATGAAGTGGGTGAATGG - Intergenic
1063716953 10:8537351-8537373 TCAGAAGAGCAGAGGGTAAAAGG - Intergenic
1064079996 10:12300646-12300668 GCAGGCAAGCAGAGAGTGAAAGG + Intergenic
1065746091 10:28843839-28843861 TCTACCAAGAAGAGGATGAAAGG + Intergenic
1066046610 10:31600864-31600886 TCTGAGAAGCAGGAGGTGAGAGG - Intergenic
1066098458 10:32095383-32095405 TATTACAAGCAGAGAGTTAAGGG + Intergenic
1068267664 10:54673978-54674000 TCTGATAAGAAGAGGGGCAATGG - Intronic
1068656343 10:59579869-59579891 TCCGAGAAGGAGAGGGTGAGGGG - Intergenic
1069360023 10:67631925-67631947 TCAAAGAAGCAGAGGGTAAAAGG + Intronic
1069435538 10:68379035-68379057 TCAGATAAACAGATGGTGAATGG + Intronic
1070232542 10:74584817-74584839 ACTGACAAGCCAAGGGGGAATGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072166820 10:92821567-92821589 GCTTACAATCAGAAGGTGAAGGG + Intergenic
1075594454 10:123718145-123718167 TGTGCCAGGCAGTGGGTGAAAGG + Intronic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1078357210 11:10641490-10641512 TTTGAGAGGCAGAGGGTGAGAGG - Intronic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1081541454 11:44037473-44037495 TCAGAGAAGCAGCGGGTGAGAGG - Intergenic
1081603305 11:44510602-44510624 TTTGACCAGCAGAACGTGAATGG - Intergenic
1082227313 11:49723856-49723878 TCCGTCAAGCAGAGGGTATAGGG - Intergenic
1084163787 11:67365632-67365654 TGTGAAAAGGAGAGGGTGATGGG + Intronic
1087816157 11:102661364-102661386 TTTGAGAAGCATTGGGTGAACGG + Intergenic
1089676125 11:120090869-120090891 TCTGAAAGCCAGAGGATGAATGG - Intergenic
1089892318 11:121893982-121894004 TCTGACGAGCAGAGTAAGAATGG + Intergenic
1090763985 11:129861306-129861328 TCTGTCAACCAGAGGCTCAATGG + Intergenic
1090806952 11:130208783-130208805 TCTGCCAGGCAGAGGGAGACTGG - Intronic
1093138756 12:15482108-15482130 AGTGTCCAGCAGAGGGTGAATGG + Intronic
1095773246 12:45985981-45986003 TCAGAGAAGTAGAGGGTGAGTGG - Intronic
1096157986 12:49352035-49352057 TCTTAAAACCAGAGAGTGAAAGG + Exonic
1101029347 12:100644581-100644603 TCTGACACACAGAGTGTAAAGGG + Intergenic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1102398649 12:112609833-112609855 TCTGACACGCAGTGGGCCAATGG + Intronic
1103541357 12:121668848-121668870 TCTGACCAGCAGGGGGCAAAGGG - Intronic
1103679591 12:122682715-122682737 TCTGCCAGCCAGAGAGTGAATGG + Intergenic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1103886694 12:124207829-124207851 TCTTACAAGTGGAGGGAGAAAGG + Intronic
1106687722 13:32078881-32078903 TCTGGCACGCACAGGGAGAAAGG + Exonic
1107015101 13:35701988-35702010 TCTGACAGGAAGAGGAAGAATGG - Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109019458 13:57068676-57068698 ACTGAAAAGAAGAAGGTGAATGG + Intergenic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1122346045 14:101061008-101061030 TCTGGGAAGCAAGGGGTGAAGGG + Intergenic
1122865554 14:104602446-104602468 TCTGGGAAGCTGAGGGTGGAGGG - Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125601915 15:40919948-40919970 TCTGGAAAGCAGAGGGTGAGAGG + Intergenic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1128703977 15:69825236-69825258 TCTCAAAAGCACAGGGAGAAAGG - Intergenic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1132386386 15:101403647-101403669 TCTGAGAAGCTGGGGGTGACAGG - Intronic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132948700 16:2547885-2547907 TCTGAGCAGGAGAGGGTGACCGG + Intronic
1132965887 16:2654242-2654264 TCTGAGCAGGAGAGGGTGACCGG - Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1134494635 16:14723044-14723066 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134500018 16:14762164-14762186 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134545843 16:15107563-15107585 TCTCACAAGCAAAGGGAGAATGG + Intronic
1136173227 16:28500659-28500681 TCAGAGAATCAGAGGGAGAAAGG + Intronic
1139012101 16:62646452-62646474 TTTGACAACCAGAGGCTAAAAGG + Intergenic
1141407028 16:83803776-83803798 CCTGACAAGCAGAGGGTCTCAGG - Intergenic
1141477432 16:84283288-84283310 GCTGTCAAGCAGAGGGACAAGGG + Intergenic
1142521382 17:507286-507308 TTCTGCAAGCAGAGGGTGAAAGG + Intergenic
1143852516 17:9823346-9823368 GCTGCCAAGCAGAGGAGGAAGGG - Intronic
1143957658 17:10685640-10685662 TCTGAAAAGCAAAAGATGAAAGG - Intronic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1144438875 17:15263445-15263467 TCTGCCAAGCCGAGACTGAAGGG - Intronic
1146087840 17:29846490-29846512 GATGACAAACTGAGGGTGAAAGG - Intronic
1146612380 17:34319239-34319261 TCTGTGGAGCAGAGGCTGAAGGG - Exonic
1147762133 17:42805575-42805597 AATGACAAGCAGAGTGTGAGGGG + Intronic
1148554160 17:48567919-48567941 GGAGGCAAGCAGAGGGTGAAGGG - Intronic
1151969645 17:77451093-77451115 TCTGGCAAGCACAGGGACAAGGG + Intronic
1152514693 17:80816485-80816507 CCAGGCAAGCCGAGGGTGAAGGG + Intronic
1153355728 18:4133346-4133368 TCTGATAGGCAAATGGTGAATGG - Intronic
1154145882 18:11865878-11865900 TCAGACATGCTGAGGGTGACTGG - Intronic
1156985770 18:43349852-43349874 TCTGAGAACCAGAGGGACAAAGG + Intergenic
1157741360 18:50096310-50096332 TGTGAGAAGCAGATGTTGAAAGG - Intronic
1159192329 18:65062486-65062508 TGTGCCAAGCAGTGTGTGAAAGG - Intergenic
1160083269 18:75751332-75751354 ACACACAAGCAGAGGGAGAAAGG - Intergenic
1163193422 19:15696695-15696717 TCAGACCAGCAGATGGAGAAGGG - Intronic
1166872563 19:45879662-45879684 GCTTTCAAGCAGAGGGTAAAGGG - Intergenic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1167836927 19:52080572-52080594 ACTGACAAGAACAAGGTGAAAGG + Intronic
1167881913 19:52466103-52466125 TCTGAGAAGCAGATGTTGAGGGG + Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925673577 2:6337250-6337272 TCTGAGAAGCACAGTGTGAGAGG + Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
926888321 2:17617760-17617782 CCTGACAAGCTGAGGATGAACGG - Intronic
927404451 2:22751408-22751430 TCTGAGGACCACAGGGTGAATGG - Intergenic
928233939 2:29523691-29523713 TCTGACAAGCACGGGGTTACAGG + Intronic
928843457 2:35639032-35639054 TCTGTCAAGTAGATCGTGAATGG + Intergenic
931083665 2:58804614-58804636 CCTGACTAGCACAGGGTAAAGGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932662066 2:73663745-73663767 TCATACATACAGAGGGTGAAAGG - Intergenic
933419553 2:82028690-82028712 TCTGACAAACTGGGGGTGCAGGG - Intergenic
933970635 2:87467171-87467193 TCTGGCAAGCAGAGGGCAGATGG - Intergenic
936323094 2:111483011-111483033 TCTGGCAAGCAGAGGGCAGATGG + Intergenic
936952811 2:117995122-117995144 TCTGAAGAGCAGATGATGAATGG - Intronic
937607236 2:123815739-123815761 TCTTACAAGCACAGAGTAAAAGG - Intergenic
939619860 2:144405512-144405534 TGTGACATTCAGAGGGTGGAGGG - Intronic
941555309 2:166972137-166972159 TCTCACATGCAGAGAGTGAGAGG - Intronic
943075795 2:183192907-183192929 TGAGAAAAGCAGAGGGTCAAAGG - Intergenic
944088648 2:195878834-195878856 TCTTACCAGAAGATGGTGAAAGG + Intronic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
945935985 2:215903160-215903182 TTGGAGAAGAAGAGGGTGAAGGG - Intergenic
946180310 2:217945138-217945160 TCAGACATCCAGAGGTTGAAAGG + Intronic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
1170337581 20:15287587-15287609 TATCACTAGCAGAGAGTGAATGG - Intronic
1170416542 20:16148699-16148721 TCTGACAAGGGGAGGGTAAAAGG + Intergenic
1170464202 20:16608130-16608152 TGTGACTAACAGAGGGGGAAGGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171557521 20:26091994-26092016 TGTGACAAGCACAGGGAGAGAGG + Intergenic
1172718838 20:36983933-36983955 TCTAACAAGCAGAGCCTGGAGGG - Intergenic
1174351189 20:49969470-49969492 TCACATAAGCAGAGGTTGAAGGG + Intergenic
1174831136 20:53813288-53813310 CCTGACAAGCAGAGAGAAAATGG - Intergenic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1176653543 21:9570778-9570800 TGTGACAAGCACAGGGAGAGAGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1179893328 21:44348786-44348808 GCTGACATGGAGCGGGTGAAAGG + Intergenic
1179944828 21:44666071-44666093 TCTGATGAGCACTGGGTGAAGGG + Intronic
1179946475 21:44681459-44681481 TCTGATGAGCACTGGGTGAAGGG + Intronic
1182245382 22:28953349-28953371 TCTGTCAAGCAGTGGCTGAGGGG - Intronic
1183035161 22:35135576-35135598 TTTGGCAAACTGAGGGTGAAGGG + Intergenic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
949651013 3:6159490-6159512 GCTGAAAAGCAGATCGTGAAGGG - Intergenic
949679850 3:6500358-6500380 TTTAACAAGATGAGGGTGAATGG - Intergenic
950366474 3:12488752-12488774 TCTCAAAATCAGACGGTGAAGGG - Intronic
950521073 3:13498486-13498508 GGAGACAAGCAGAGGGTGAGGGG - Intronic
950694267 3:14685699-14685721 TCATAGAAGCAGAGAGTGAATGG - Intronic
951569234 3:24044612-24044634 ACTGAAAAGAAGAGGGTAAACGG - Intergenic
951742402 3:25939042-25939064 GTGGACAAGCAGAGGGTGAGAGG + Intergenic
951809667 3:26685358-26685380 TTTGACAAGCAGAGACTGAAGGG - Intronic
952712035 3:36441241-36441263 ACTGGCAAGCACAGGGAGAAGGG - Intronic
953201494 3:40781922-40781944 TCTGAGGAGCAGGTGGTGAATGG + Intergenic
958485016 3:94694280-94694302 TCTGACAAGAACAGGGTCAAGGG - Intergenic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
961240863 3:125410142-125410164 TCTCCCAAGCAGAGAGTGAGGGG + Intergenic
962499396 3:135974666-135974688 GCTGAGAAGCAGAGTTTGAAAGG - Intronic
962882137 3:139588182-139588204 TCTGAGCAGCAGAGGGTCACAGG - Intronic
963327536 3:143878931-143878953 GCTGACAAGGGGAGGGAGAAGGG - Intergenic
963383556 3:144561262-144561284 TCTGAAAAGGGGAGGGTAAAGGG - Intergenic
963788121 3:149556067-149556089 GCTGAGGAGCAGAGGGTGAGGGG + Intronic
964241747 3:154602212-154602234 TGTAACAGGCAGAGGTTGAAAGG - Intergenic
965603915 3:170481176-170481198 CCGGGCAAGCAGAGGGTTAATGG + Intronic
966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG + Intronic
970537201 4:17041837-17041859 TCTGGCAAGAACAGGCTGAAGGG + Intergenic
970967363 4:21944076-21944098 TCTGACGAGCAGAAGAGGAATGG + Intronic
971119340 4:23686827-23686849 TCTGAAAATCAGAGGTTGGAAGG - Intergenic
971359834 4:25927111-25927133 TCTGAAAAGTAGCGGATGAATGG - Intronic
971911618 4:32802525-32802547 TCAGCCACGCAGAGAGTGAAAGG - Intergenic
972565532 4:40265763-40265785 TCTGCCATGGCGAGGGTGAAGGG + Intergenic
975710906 4:77158403-77158425 CCCGACAAGGAGCGGGTGAAGGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976215176 4:82709278-82709300 TATGACAAGCCGAGGCTGAATGG - Intronic
979647459 4:123088207-123088229 TCAGGCAAGCAAAGGGTGAAAGG - Intronic
982087893 4:151854692-151854714 CCAGAAAAGCAGAGGATGAAAGG + Intergenic
982545255 4:156725011-156725033 TCGGACAAGTGGAGGGTGAAAGG - Intergenic
983061997 4:163171468-163171490 TCTTACAAGCTGAGTGTGAGAGG - Intergenic
986050608 5:4086595-4086617 TCTGAGAAGCACAGGATAAACGG + Intergenic
986084192 5:4426719-4426741 TCTGCCCTGCAGAGGGTGATTGG + Intergenic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
987307870 5:16655124-16655146 TCTGACAAATAGAAGGTGACAGG - Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
991166202 5:63567197-63567219 TCTGACTAACAGAGGATGTAAGG + Intergenic
991204080 5:64030145-64030167 TCTGACAAGCAGATGGTATCTGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
996382421 5:122875730-122875752 TCTGAAAAGCAGGAGGAGAATGG + Intronic
1001870644 5:175151329-175151351 TCTGACATGCAGCTGGTCAATGG + Intergenic
1002456795 5:179349875-179349897 GCTGACAGGCGGTGGGTGAAGGG + Intergenic
1002639771 5:180625252-180625274 TTAGACAAGCAGGGGGTGAGAGG - Intronic
1002641372 5:180632180-180632202 TCTGGGAAGCAGCGGGTGTAGGG - Intronic
1004255680 6:14061645-14061667 TCTGATAAAAAGAGGTTGAAGGG + Intergenic
1005384875 6:25276179-25276201 TCTGACTAGAAGACGGTGGAAGG - Intergenic
1006897977 6:37482889-37482911 TCTGACTAGCGGAGGGTGGACGG - Intergenic
1009331918 6:62433411-62433433 TCTGACAAGCAAATGCTGAAAGG + Intergenic
1009969641 6:70613327-70613349 TCTGACTAGCTGAGGGTGGTAGG + Intergenic
1011413371 6:87090016-87090038 TCTGAAATGCTGAGGATGAAAGG - Intronic
1013443582 6:110197623-110197645 TCATAGAAGCAGAGAGTGAATGG - Intronic
1015312085 6:131777234-131777256 TCTGATAAGCACAGGGAGACAGG - Intergenic
1016638941 6:146326435-146326457 TTTGAGGGGCAGAGGGTGAAAGG + Intronic
1017207329 6:151817508-151817530 TTTCAGAAGCAGAGGGTAAAAGG + Intronic
1020352391 7:7235351-7235373 CCTCTCAAGCAGAGGTTGAATGG + Intronic
1021035414 7:15792338-15792360 GCTGACAAGGATATGGTGAAAGG + Intergenic
1021040941 7:15861309-15861331 TGTCACAAGTAGAGTGTGAAAGG - Intergenic
1021054884 7:16035351-16035373 TCTGACAGGCAGGGTTTGAATGG - Intergenic
1021466697 7:20952421-20952443 ACTGACAATCACAGGGAGAATGG + Intergenic
1022323418 7:29308348-29308370 TCTGACTAACAGAGGAGGAAGGG - Intronic
1024310721 7:47966567-47966589 CCTGACAAGCACAGTGTGAATGG - Intronic
1025072822 7:55915915-55915937 TGTGAGAGGCAGAGGTTGAAAGG + Intronic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026303551 7:69120163-69120185 TCTGGGAAGCAGAGGTTGGAGGG + Intergenic
1029877675 7:103771224-103771246 TTTTACAAGCAGAAGGTGATTGG - Intronic
1030278731 7:107747193-107747215 TCTGTGAAGCAGAGTGGGAAGGG + Intronic
1035079094 7:156201486-156201508 TCTGACAGGCAAAAGATGAAAGG + Intergenic
1035432204 7:158830226-158830248 CCTGACAAGCAGGGTGGGAAGGG - Intronic
1035698609 8:1620937-1620959 TCTGGAGAGCAGAGGGTAAAGGG - Intronic
1037077489 8:14738808-14738830 TCTGAAAATGAGAGGGAGAACGG + Intronic
1037594652 8:20344814-20344836 ACCTACAAGCAGAGTGTGAAAGG - Intergenic
1038621628 8:29148981-29149003 TGTGACAAGCTCAGAGTGAAAGG + Intronic
1038687718 8:29733806-29733828 TGGGACCATCAGAGGGTGAAGGG - Intergenic
1039239387 8:35538626-35538648 TCAGACAAGCATAGGAAGAATGG + Intronic
1043261085 8:78197717-78197739 ACTGACAAATAGAGTGTGAAGGG + Intergenic
1043572633 8:81622193-81622215 TCTGAGAAGCAGGGGTTGTAAGG - Intergenic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1048280217 8:133100231-133100253 TCTGATAAGCAGACCCTGAAGGG - Intronic
1048421439 8:134282251-134282273 TCAGAGAAGAAAAGGGTGAAGGG + Intergenic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1049532320 8:143160563-143160585 TCAGCCAAGCAGAGGGGGAAGGG - Exonic
1050160270 9:2711604-2711626 TCTGAAAGGCAGAGGGAGAGAGG - Intergenic
1050245706 9:3687821-3687843 TCTGTCATTCAGAAGGTGAAAGG - Intergenic
1051786852 9:20754155-20754177 GCTAACAAGCAGTGGGTGAGAGG + Intronic
1058985992 9:110208519-110208541 GCTGGCAAGCAGAGAGTGAGGGG - Intergenic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1060760589 9:126245064-126245086 TCTGGCAAGAAGAGGCTCAAGGG + Intergenic
1061648284 9:132024531-132024553 TCTGACATGCTTAGGGTGACAGG - Intronic
1203631262 Un_KI270750v1:74225-74247 TGTGACAAGCACAGGGAGAGAGG - Intergenic
1185617546 X:1432525-1432547 TCGGACAAGAAAAGGGAGAAAGG + Intronic
1185887324 X:3794388-3794410 TCATAGAAGCAGAGGATGAATGG - Intergenic
1185925856 X:4145134-4145156 TCTGAGAACCAGAGGATGTATGG + Intergenic
1186136888 X:6530924-6530946 TGTGACATGCAGAGCTTGAATGG + Intergenic
1186264929 X:7822125-7822147 TCTGACAAGAAGAGAGTGTTAGG + Intergenic
1186267411 X:7847198-7847220 TTTGACATGCAGAGCTTGAATGG - Intergenic
1186297590 X:8167355-8167377 TGTGACATGCAGAGCTTGAATGG + Intergenic
1188354734 X:29176843-29176865 ATTGACAAGCAGAGGGAGATTGG + Intronic
1188598513 X:31931264-31931286 GTTGTCAAGCAGAAGGTGAAAGG - Intronic
1189279408 X:39810623-39810645 TCTGTCAAGCAGAAGGTGCCAGG - Intergenic
1189982211 X:46522143-46522165 TCTGACAAGCAGAAGTGGCACGG + Intronic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190904361 X:54711140-54711162 TCTGGCAAGCAGAGGAAGACAGG - Intergenic
1191036127 X:56028137-56028159 TCTGACACATAGAGTGTGAAGGG + Intergenic
1195661654 X:107384864-107384886 TCTGACCAGCAGAGCCAGAAGGG + Intergenic
1195864648 X:109416491-109416513 TCTGAAAAACAGAGGGAAAAAGG + Intronic
1196164016 X:112518527-112518549 ACTTACAACCAGAAGGTGAAGGG + Intergenic
1196422892 X:115540832-115540854 TCTGACACACAGAGTGTAAAGGG + Intergenic
1198167893 X:134075249-134075271 TTTGAGAAGCATTGGGTGAACGG - Intergenic
1200775021 Y:7162754-7162776 TCATAGAAGCAGAGGATGAATGG + Intergenic
1201907263 Y:19098501-19098523 TCATAGAAGCAGAGGATGAATGG + Intergenic
1201962929 Y:19701994-19702016 TCTCACAAGTGGCGGGTGAATGG + Intergenic