ID: 1132479837

View in Genome Browser
Species Human (GRCh38)
Location 16:161501-161523
Sequence TCTAGTAATTCCCCTTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132479837 Original CRISPR TCTAGTAATTCCCCTTCTAG AGG Intronic
902063237 1:13662894-13662916 CCTAGCAATTCTGCTTCTAGAGG + Intergenic
903373195 1:22850137-22850159 TGTAGCACTTCCCCTTCTATGGG - Intronic
906643323 1:47454991-47455013 TCTAGTAAGTCCAGTTCAAGTGG + Intergenic
906741267 1:48187768-48187790 TCAATTAATCCCCCTTCTTGTGG - Intergenic
909180896 1:72422405-72422427 TATAGTAATTTCACTACTAGTGG + Intergenic
911793345 1:102046477-102046499 CCAATTAATTCCCCTTCTTGTGG + Intergenic
912693540 1:111822732-111822754 TCCAGCAATTCCACTTCTGGTGG - Intronic
915576059 1:156778545-156778567 TCCAGTAATTCCACTTCTCTAGG - Intronic
916022527 1:160806423-160806445 TCTTGTAAGACCCCATCTAGTGG + Intronic
916593843 1:166222702-166222724 TTTTGTAATTCTCCTTGTAGAGG + Intergenic
919876874 1:201875702-201875724 TGTTGTAATTCATCTTCTAGAGG + Intronic
922354204 1:224760648-224760670 TCCAGTATTTCCCCCTCTTGGGG + Intergenic
922394876 1:225187650-225187672 TTTATTATTTCCCATTCTAGCGG + Intronic
924704230 1:246486329-246486351 TCTATTATTACCCATTCTAGAGG - Intronic
1066421212 10:35266527-35266549 TCTATTACTTCCCCATATAGAGG + Intronic
1068944401 10:62714570-62714592 TCTTGTAGTTCTCCTTATAGAGG - Intergenic
1069843645 10:71355734-71355756 TCTCTTTATTGCCCTTCTAGTGG - Intronic
1072185703 10:93036611-93036633 CCCAGTAATTCCACTTCTAAAGG - Intronic
1072665767 10:97391162-97391184 TCCAGGAATGCCCCTTCTGGGGG + Intronic
1074059259 10:109950086-109950108 TCTAATAATTCCCCTTATATAGG - Intronic
1074324258 10:112432628-112432650 CCTTCTAGTTCCCCTTCTAGGGG + Intronic
1078270394 11:9789291-9789313 TGTAGTAATCCCACTTCTTGAGG + Exonic
1088530032 11:110798670-110798692 TGTACTACTTCCCCTTGTAGGGG - Intergenic
1090517101 11:127440463-127440485 TATAGTCATTCCCCTACTATTGG - Intergenic
1090588046 11:128235636-128235658 TCTACTTACTGCCCTTCTAGTGG - Intergenic
1095876270 12:47082173-47082195 TCTTGGAATTTACCTTCTAGTGG - Intronic
1099352224 12:81588028-81588050 TCTAGGAATTCCCAATCTAGTGG + Intronic
1102154890 12:110717185-110717207 TCTAGTTATTCCTCTTCTGTGGG + Intergenic
1106035836 13:26044276-26044298 TCTAGGAATTCCACTTCCAGAGG + Intergenic
1106541426 13:30693848-30693870 TTTTGTAATTCTCCTTGTAGGGG + Intergenic
1108168182 13:47713803-47713825 TCTTGTAATTGCTCTTCTCGAGG - Intergenic
1110214611 13:73012012-73012034 TCTAGTATTTCTCCTTTTTGGGG - Intronic
1111932650 13:94527174-94527196 TCTATGAATTCCACCTCTAGGGG + Intergenic
1111937094 13:94568832-94568854 TCCAGCAATTCCACTTCTAGGGG - Intergenic
1114068155 14:19084076-19084098 GGTAGTAATTCCACTTCCAGGGG - Intergenic
1114094107 14:19315950-19315972 GGTAGTAATTCCACTTCCAGGGG + Intergenic
1118414186 14:65515392-65515414 TCTATGAATATCCCTTCTAGAGG - Intronic
1122698132 14:103567936-103567958 TCTAGTGTTTGCCCTTCTGGTGG + Intronic
1123479923 15:20621620-20621642 TCTAGAAAATACCCTTCAAGTGG + Intergenic
1123638084 15:22378744-22378766 TCTAGAAAATACCCTTCAAGTGG - Intergenic
1126228985 15:46303445-46303467 TCTATCAATTCCCCTTCATGAGG - Intergenic
1132479837 16:161501-161523 TCTAGTAATTCCCCTTCTAGAGG + Intronic
1133606794 16:7395360-7395382 ACTACTAATTCCCCTTTTAGTGG + Intronic
1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG + Intergenic
1140264632 16:73409623-73409645 TATACTAATTTCCCTTCTTGGGG - Intergenic
1141564825 16:84894102-84894124 TCCAGGAAGTCCTCTTCTAGAGG - Intronic
1148247173 17:46040525-46040547 TCTAGAAATTCCTTTTCTAAAGG - Intronic
1149302752 17:55319827-55319849 TCTGCCAATCCCCCTTCTAGAGG + Intronic
1151015962 17:70552984-70553006 TTTAGAAATTCCCCTTTGAGTGG - Intergenic
1154499683 18:14989612-14989634 TGTAGAAATTTTCCTTCTAGTGG + Intergenic
1156716286 18:40015373-40015395 TCTTGTAATTCCCTCTCTTGGGG + Intergenic
1156837327 18:41569671-41569693 TCTAGGGATTCTCATTCTAGTGG - Intergenic
1157886029 18:51367417-51367439 TCTAGAAATTCCCCTTTCAAAGG - Intergenic
1160361042 18:78279158-78279180 TATTGTAGTTCTCCTTCTAGAGG + Intergenic
1161300778 19:3542188-3542210 TCTTGAAATTGCCTTTCTAGTGG + Intronic
1163955242 19:20632265-20632287 TCTTGGAATTCCTCTTCTCGAGG + Intronic
1165170980 19:33891441-33891463 TCTGGTATTTCCTCTTCTAAGGG - Intergenic
1166771641 19:45287003-45287025 TCTAGTCATTCCTCTACTAAGGG + Intronic
1167650379 19:50725448-50725470 TCTGCGAGTTCCCCTTCTAGCGG + Exonic
929526718 2:42710598-42710620 TATAGTAATCCCCCTTCTGTGGG - Intronic
932565794 2:72907955-72907977 TGTATTTATTCCTCTTCTAGAGG - Intergenic
936819765 2:116505908-116505930 TTTTGTAATTCTCCTTATAGAGG + Intergenic
938498893 2:131819966-131819988 TGTAGAAATTGTCCTTCTAGTGG + Intergenic
938561778 2:132478869-132478891 TATTGTATTTACCCTTCTAGTGG - Intronic
941201693 2:162519269-162519291 TTCAGTAATTCTCCTTCTAATGG - Intronic
942300721 2:174558934-174558956 ACTAGTAGATCCCCTTCTAGTGG + Intergenic
944451874 2:199851491-199851513 TCTGGTAAATCCCCTCCTGGAGG + Intergenic
1170423128 20:16212114-16212136 TCTTGTTCTTCCCCTTCTAATGG - Intergenic
1171970424 20:31561561-31561583 ACTAGTAATACCCCTTCTGAGGG - Intronic
1175265561 20:57701385-57701407 CCTAGGAATTCTCCTTCTGGGGG + Intronic
1176699164 21:10022055-10022077 TCTTGTACTTCTCCTTGTAGTGG - Intergenic
1176710903 21:10148202-10148224 TGTAGAAATTTTCCTTCTAGTGG - Intergenic
1177064401 21:16411663-16411685 TTTTGTAATTCCCCTTGAAGAGG + Intergenic
1180486628 22:15806640-15806662 GGTAGTAATTCCACTTCCAGGGG - Intergenic
1180648527 22:17359718-17359740 TCTATTACTTCCCCTTCCATGGG - Intergenic
955679048 3:61481215-61481237 TCTAGTAACCACCATTCTAGTGG - Intergenic
957344733 3:78946187-78946209 TCTTGGAATTGCCCTTCTCGAGG - Intronic
959200854 3:103244907-103244929 TCTTGTAATTCCCCAGCTAGTGG - Intergenic
960856261 3:122105289-122105311 TCTGGCAATTCACCTTCTACAGG + Intronic
966338665 3:178900720-178900742 TGTAGAAATTCCCTTTCAAGAGG - Intergenic
967765319 3:193272583-193272605 TGTAGTAATTCCCCTGCTTCGGG - Intronic
971822589 4:31577628-31577650 TCTATTAATTTACCTTCTTGAGG + Intergenic
973547644 4:51997859-51997881 TCTAGAATTTCCCCATCTAGTGG - Exonic
973734366 4:53856058-53856080 TCAAGTAATTCATCTCCTAGGGG - Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
975938309 4:79609161-79609183 TTTAGTAGTTCTCCTTGTAGAGG + Intergenic
975954693 4:79823716-79823738 TCCAGTAACTGCCCTTCTAATGG + Intergenic
978797701 4:112724783-112724805 TCTAGCAGTCCCACTTCTAGAGG + Intergenic
979428649 4:120599327-120599349 TTTTGTAATTCTCCTTGTAGAGG - Intergenic
982793331 4:159617226-159617248 TCTAGTAACTGGCCTTCTGGTGG + Intergenic
984224575 4:177018877-177018899 TCTTGGAATTGCCCTTCTCGAGG - Intergenic
985146244 4:186897002-186897024 TCTAGGAAGTCCCCTTCCATGGG - Intergenic
988296352 5:29367844-29367866 TTTATTAATTTCCCTTCTGGAGG + Intergenic
995674819 5:114651613-114651635 TCTAGCCATTCTCCTCCTAGAGG - Intergenic
996805775 5:127452627-127452649 TTTAGTCTTTCCCCTTCCAGAGG + Intronic
999532406 5:152478807-152478829 TCTATTAATTCTCATCCTAGAGG + Intergenic
999648382 5:153741382-153741404 TCCAGCAATCCCACTTCTAGGGG + Intronic
1000476154 5:161710412-161710434 TCTAGTAATTGTCCATCTACTGG + Intergenic
1006827054 6:36942905-36942927 TCTATTAATTCTCATACTAGAGG - Intergenic
1009998819 6:70926841-70926863 TCTTGGGATTCCCCTTCTGGAGG - Intronic
1013274296 6:108569631-108569653 TCTAGTAATTCCGCTACTCCTGG + Intronic
1015313586 6:131792410-131792432 TGTGGGACTTCCCCTTCTAGTGG + Intergenic
1020506856 7:9001533-9001555 TCTAGGAGTTCACCATCTAGTGG - Intergenic
1022384336 7:29887678-29887700 TCTAGTGATTCCCCTGCTTTGGG + Intronic
1024360982 7:48468139-48468161 TCTAGTCCTTCTCCTTCCAGAGG + Intronic
1031835541 7:126677329-126677351 TCTAGCAATCCCACTACTAGGGG + Intronic
1032163874 7:129530748-129530770 CCCAGCAATTCCCCTTCTAGGGG + Intergenic
1035369637 7:158371665-158371687 CCTAGGAATTTCACTTCTAGGGG + Intronic
1035932725 8:3801439-3801461 TCCAGTGATAGCCCTTCTAGTGG - Intronic
1039574975 8:38615837-38615859 TCTAGCAATCCTCCATCTAGTGG - Intergenic
1043406699 8:79942874-79942896 TTTAGAATTTCCCCTTCTTGGGG - Intronic
1044917847 8:97134912-97134934 TCTTGTAATTCCCCTATTTGGGG + Intronic
1046920506 8:119723108-119723130 TCTAGTCTTTCCCCTCCTCGGGG - Intergenic
1047503128 8:125457638-125457660 TCCAGCAATTCCACTTCTGGGGG - Intergenic
1048039847 8:130716518-130716540 TCTAGGCATTCCCCTTCTCTGGG + Intergenic
1050623537 9:7479479-7479501 TCAAGGAATTCTCCCTCTAGTGG + Intergenic
1051753089 9:20365174-20365196 TCTAGAAATTCCCCTTTTTCCGG - Intronic
1053041250 9:34874588-34874610 TTTAGTAATTCCCCTAATAGGGG + Intergenic
1053636277 9:40008243-40008265 TCTTGTACTTCTCCTTGTAGTGG - Intergenic
1053647886 9:40133898-40133920 TGTAGAAATTTTCCTTCTAGTGG - Intergenic
1053757846 9:41329948-41329970 TGTAGAAATTTTCCTTCTAGTGG + Intergenic
1053769715 9:41456405-41456427 TCTTGTACTTCTCCTTGTAGTGG + Intergenic
1054317143 9:63605323-63605345 TCTTGTACTTCTCCTTGTAGTGG - Intergenic
1054328860 9:63731850-63731872 TGTAGAAATTGTCCTTCTAGTGG - Intergenic
1054536694 9:66242272-66242294 TGTAGAAATTTTCCTTCTAGTGG + Intergenic
1054548383 9:66367884-66367906 TCTTGTACTTCTCCTTGTAGTGG + Intergenic
1055314585 9:75021584-75021606 CCTAATAATTCCTCTTCTAGAGG + Intronic
1202795661 9_KI270719v1_random:117190-117212 TGTAGAAATTTTCCTTCTAGTGG - Intergenic
1186998047 X:15144722-15144744 TCTAGGCATTTCCCTTCCAGTGG + Intergenic
1188868743 X:35347789-35347811 TCTAGAACATGCCCTTCTAGAGG + Intergenic
1190001665 X:46694553-46694575 TCTGATAATTGCCATTCTAGTGG - Intronic
1193401378 X:81047705-81047727 TTTTGTAATTCTCCTTATAGAGG + Intergenic
1194240951 X:91447378-91447400 TCTACTACTTGCTCTTCTAGGGG - Intergenic
1195901192 X:109799116-109799138 CCTACTCCTTCCCCTTCTAGAGG + Intergenic
1196139918 X:112249886-112249908 TCTTGTAATGCCCCTGCAAGAGG + Intergenic
1197374702 X:125668019-125668041 TTTTGTAATTCTCATTCTAGAGG - Intergenic
1197940798 X:131787262-131787284 TTAAGTAATTCCCATTCTAGTGG + Intergenic
1198407425 X:136327866-136327888 TCTAGTAATTTTACTTTTAGAGG - Intronic
1198935628 X:141900461-141900483 TTTAGAAATTCACCTTCTTGTGG - Intergenic
1199586152 X:149418458-149418480 TCAAATAATTCCACTCCTAGGGG + Intergenic
1201344517 Y:12967926-12967948 CCAATTAATTCCCCTTCTTGTGG - Intergenic
1201520999 Y:14873523-14873545 CCAAGTAATTCCTCCTCTAGAGG - Intergenic
1201675746 Y:16582321-16582343 TCTCCTCATTCTCCTTCTAGAGG - Intergenic