ID: 1132480948

View in Genome Browser
Species Human (GRCh38)
Location 16:165871-165893
Sequence CGGGGACCCTCGGCCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 277}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132480948_1132480961 13 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480961 16:165907-165929 CTCGGGCCGATAAGGACGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1132480948_1132480951 -5 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480951 16:165889-165911 CCCCGCGTTCCCGCCGCGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 91
1132480948_1132480962 14 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480962 16:165908-165930 TCGGGCCGATAAGGACGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 17
1132480948_1132480966 25 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480966 16:165919-165941 AGGACGGGCGGGGTGCCCGGAGG 0: 1
1: 0
2: 2
3: 23
4: 240
1132480948_1132480965 22 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480965 16:165916-165938 ATAAGGACGGGCGGGGTGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 85
1132480948_1132480963 15 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480963 16:165909-165931 CGGGCCGATAAGGACGGGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 28
1132480948_1132480960 10 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480960 16:165904-165926 GCGCTCGGGCCGATAAGGACGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1132480948_1132480957 5 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480957 16:165899-165921 CCGCCGCGCTCGGGCCGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 27
1132480948_1132480959 9 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480959 16:165903-165925 CGCGCTCGGGCCGATAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 12
1132480948_1132480953 -4 Left 1132480948 16:165871-165893 CCGGCGCAGGCCGAGGGTCCCCG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132480953 16:165890-165912 CCCGCGTTCCCGCCGCGCTCGGG 0: 1
1: 0
2: 2
3: 20
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132480948 Original CRISPR CGGGGACCCTCGGCCTGCGC CGG (reversed) Intronic
900480187 1:2894458-2894480 CGAGGACCCTTGGCCTGGGGAGG - Intergenic
901035995 1:6336627-6336649 CGGGGACCCTGGCCCGGAGCAGG - Intronic
901110040 1:6786155-6786177 CGGGGACCCCCCGCCCGCTCAGG - Intronic
904068490 1:27773592-27773614 CGGGGACCCTCGGGCAACCCGGG - Intronic
905626331 1:39492345-39492367 CGGGGACCCTCGGAGTAAGCTGG + Intronic
905670564 1:39788110-39788132 CGGGGACCCTCGGAGTAAGCTGG - Intronic
906168962 1:43707768-43707790 CCGGGACCCGCGGCCGGCGGGGG - Intronic
908951547 1:69568129-69568151 TGGGGATCCTCGCCCTGCACAGG + Intergenic
910981315 1:92961834-92961856 CGGCGACCCCCGGACCGCGCTGG + Intergenic
913157461 1:116113969-116113991 CTGGGGCCCTTGGCCTGCTCAGG - Intronic
916414065 1:164576504-164576526 CGGTGACGTGCGGCCTGCGCTGG - Intronic
916940105 1:169668308-169668330 CGGGGAGGCTCGGGCTGCACAGG - Intronic
917406192 1:174710932-174710954 CGGGGAGGCTCAGGCTGCGCAGG + Intronic
917445367 1:175102363-175102385 CGGGGAGGCTCGGGCTGCACAGG + Intronic
920494570 1:206445658-206445680 CGGGGACCCTCAGGCTGCCCTGG - Intronic
920731328 1:208488501-208488523 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
921897136 1:220412729-220412751 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
922855836 1:228774001-228774023 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
923193416 1:231642012-231642034 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1063133776 10:3199409-3199431 TGGGGACCCTGGGGCTGCGCTGG - Intergenic
1063458488 10:6201522-6201544 CGGGGCCCCTCGGCAGGCGGCGG + Intronic
1064028754 10:11869831-11869853 CGGGGTGCCTTGGGCTGCGCCGG - Exonic
1066135912 10:32446151-32446173 CGGGCACCCGCCGCCGGCGCCGG - Exonic
1068216721 10:53991108-53991130 TGGGGAGACTCGGGCTGCGCGGG - Intronic
1068863213 10:61867941-61867963 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1069186480 10:65429471-65429493 CGGGGAGACTCGGGCTGCACAGG + Intergenic
1070937924 10:80315698-80315720 TGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1072341803 10:94459557-94459579 CGGGGAGGCTCGGGCCGCGCAGG + Intronic
1073209038 10:101783436-101783458 CGGGGACCCTCGGCCAGTTCCGG + Intergenic
1075144531 10:119872386-119872408 CGGGGCCCCGGGGCCTGCACCGG - Intronic
1075549990 10:123385278-123385300 CAGCGACCCTGGGCCTGCACAGG - Intergenic
1075877909 10:125823150-125823172 CGCGGCCCCTCGGGCTGCGTGGG - Exonic
1076368411 10:129936586-129936608 GGGGGACCCTCGGTCTGTGTGGG + Intronic
1076683754 10:132187562-132187584 GGGCGACCCACGGGCTGCGCCGG - Intronic
1077057973 11:605147-605169 CGCGGACGCTGGGCCTGCGCAGG + Exonic
1077103528 11:832476-832498 CTGGGACCCCAGGCCTGCCCGGG + Intergenic
1080557650 11:33431807-33431829 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1081126892 11:39333132-39333154 CGGGGAGCCTCTGGCCGCGCAGG + Intergenic
1083936656 11:65872972-65872994 GGGGGACCCTGGTCCGGCGCCGG - Intronic
1084438421 11:69157254-69157276 CGGAGACCGTGGGCCGGCGCTGG + Intergenic
1084831767 11:71774992-71775014 TGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1084975258 11:72793689-72793711 CCGAGACTCTCGGCTTGCGCAGG + Intergenic
1089700824 11:120242804-120242826 TGGTGACCCTCTGCCTGCTCAGG - Intronic
1091616484 12:2054004-2054026 CGGGGTCCCTCGCCCGGCTCGGG + Intronic
1092221444 12:6716334-6716356 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1092262247 12:6959028-6959050 CGTGGACCCCAGGCCTGCGACGG + Intronic
1093034541 12:14320391-14320413 CGGGGAGGCTCGGGCTGCCCAGG - Intergenic
1093653867 12:21674070-21674092 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1093741328 12:22693101-22693123 CGGGGAGGCTCGGTCTGCGCGGG + Intergenic
1096968335 12:55646518-55646540 CTGGCAGCCTCTGCCTGCGCTGG - Intergenic
1097246593 12:57610871-57610893 CGGGGACACTCTGCCTGCGAGGG - Intronic
1099008243 12:77260459-77260481 TGGGGACCCTGGGCCTGGCCTGG + Intergenic
1102673993 12:114644005-114644027 CGGGGAACCTCAGCCTGAGAAGG - Intergenic
1102904053 12:116660979-116661001 CGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1103146102 12:118597239-118597261 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1103668590 12:122592321-122592343 CGGGGAGGCTCGGGCTGCACAGG - Intronic
1104344535 12:127983682-127983704 CGGGGAGGCTCGGGCCGCGCAGG - Intergenic
1104580704 12:130008967-130008989 CGGCTACCCTCGGCCTTCCCTGG + Intergenic
1104580771 12:130009303-130009325 AGGGACCCCACGGCCTGCGCTGG + Intergenic
1104582679 12:130022352-130022374 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1104614473 12:130256717-130256739 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1106810990 13:33358278-33358300 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107836157 13:44413872-44413894 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1110417523 13:75268746-75268768 CGGGGAGACTCGGGCTGCACAGG - Intergenic
1110609786 13:77475559-77475581 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1113372182 13:109733903-109733925 AGGAGACCCTCGGGCGGCGCAGG + Intergenic
1113506677 13:110821457-110821479 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1113651421 13:112036543-112036565 CGTGCACACACGGCCTGCGCGGG - Intergenic
1113678096 13:112222014-112222036 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1116223150 14:42113555-42113577 CGGGGACGCTGGGGCCGCGCAGG + Intergenic
1116250996 14:42482456-42482478 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1118404809 14:65412745-65412767 GGGGAAGCCTCGGCCAGCGCCGG - Intronic
1119486825 14:74994446-74994468 AGGGGAGCCTCGGGCTGCACAGG - Intergenic
1119673409 14:76536814-76536836 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1121228529 14:92339593-92339615 GGGGGACCCTCCGCCTACCCCGG - Intronic
1122514573 14:102297986-102298008 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
1122601238 14:102922959-102922981 CCGGGAACCTCGGCCAGCCCCGG + Intronic
1122658629 14:103279499-103279521 CGGGTTCCCACGGCCGGCGCAGG - Intergenic
1122805448 14:104254049-104254071 CGGGGACCGCCTGACTGCGCAGG - Intergenic
1123037798 14:105478516-105478538 CGGCTGCCCTCGGCCTGCCCTGG + Intronic
1125398493 15:39275200-39275222 TGGGGACCCTAGGCCTCTGCTGG + Intergenic
1125609739 15:40961915-40961937 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1129158227 15:73732248-73732270 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1132480948 16:165871-165893 CGGGGACCCTCGGCCTGCGCCGG - Intronic
1132632777 16:927909-927931 CGGCGACACTTGGCCTGTGCGGG + Intronic
1132664946 16:1077275-1077297 TGGGGGACCTCGGCCTGAGCAGG - Intergenic
1132893121 16:2214317-2214339 CCGGGACCCTCGCCCTGCAGTGG + Exonic
1133020965 16:2966808-2966830 CGGGGACCAGGGGCCTGGGCGGG + Intronic
1133076347 16:3283685-3283707 CGGGGCTCCTCGGCCTGGACTGG + Exonic
1133188614 16:4116919-4116941 CCGGGGCACTCGGCCTGCCCTGG + Intergenic
1134644932 16:15858272-15858294 CGGGGACCCGCGGGCAGCCCGGG + Intergenic
1135354346 16:21757131-21757153 CGGTGACCCACGCCCAGCGCCGG + Exonic
1135452837 16:22573271-22573293 CGGTGACCCACGCCCAGCGCCGG + Intergenic
1136861541 16:33707198-33707220 AGTGGAGCCTGGGCCTGCGCCGG + Intergenic
1142062661 16:88040718-88040740 CGGAGGCCCTTGGCCTGCCCTGG + Intronic
1203123041 16_KI270728v1_random:1555389-1555411 AGTGGAGCCTGGGCCTGCGCCGG + Intergenic
1142647999 17:1327838-1327860 CCAGGACCCTCGGCCGACGCTGG + Intergenic
1143082745 17:4393881-4393903 CCGGGACCCTCGGCCCTCCCAGG + Intergenic
1148139234 17:45316806-45316828 CGGGGTACGTCGGACTGCGCTGG + Intronic
1148242640 17:46010630-46010652 CTGGGTCCCCCAGCCTGCGCAGG + Intronic
1150267773 17:63842306-63842328 CCGGGACCCTCGGGCTGCGGCGG - Intronic
1150778319 17:68099579-68099601 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1152197183 17:78924857-78924879 TGGGGTCCCTCGGCCAGCGGCGG + Intronic
1152619003 17:81352096-81352118 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1152777751 17:82213110-82213132 TGGGGACCCTCGGCCGGGCCGGG - Intergenic
1154942931 18:21132599-21132621 CAGGGAGGCTCGGGCTGCGCAGG + Intergenic
1158553922 18:58459674-58459696 CGGGGAGGCTCGGACTGCACAGG - Intergenic
1160164321 18:76496232-76496254 CGGGGAGCTGCGGCCTGCGGAGG + Intronic
1160504325 18:79418482-79418504 CGGGGACCCTCGGCCCAGACTGG + Intronic
1160932962 19:1579256-1579278 AGGTGACCCCCGGCCTGCGAGGG - Intronic
1161084241 19:2326936-2326958 CGGGGACCCTGGCCCTGCAAAGG + Intronic
1162435369 19:10654770-10654792 CGCGGCCCCTCGGCCGGCGGCGG + Intronic
1163181685 19:15608708-15608730 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1163218890 19:15899981-15900003 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1165553192 19:36605625-36605647 CGGGGACCCGCCGCCAGCGATGG - Intronic
1165846626 19:38821794-38821816 CGGGGAGGCTCGGGCTGTGCAGG - Intronic
1167156817 19:47743627-47743649 CGGGGACTCTTGGCCAGAGCTGG + Intergenic
1167300239 19:48673647-48673669 CGGGGACCCCCGGGGTGCGGGGG + Intergenic
925340315 2:3131304-3131326 TGCAGACCCTCGGCCTGCACCGG - Intergenic
927713828 2:25340934-25340956 CGGGCACCCACGGCCCGCGGTGG + Intronic
928322504 2:30294979-30295001 CAGGGACCCTGGGCCTCTGCAGG + Intronic
928688602 2:33775647-33775669 CGGGGAGACTCGGACTGCGTGGG - Intergenic
928998746 2:37324857-37324879 CGGGGGCGCGCGGCCAGCGCGGG + Intergenic
929109899 2:38397560-38397582 CGGGGAGGCTCGGGCGGCGCAGG - Intergenic
929233750 2:39585653-39585675 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
929788728 2:45009271-45009293 GTGGGACCCGCGGCCGGCGCGGG - Exonic
932178320 2:69622338-69622360 CGGGGAGGCTCCGGCTGCGCAGG - Intronic
933506353 2:83181297-83181319 CGGGGAGGCTCGGGCTGCGCAGG - Intergenic
938397805 2:130963811-130963833 CTGGGACCCTTGGCAGGCGCGGG - Intronic
942246347 2:174012598-174012620 CGGGGACCTTCACCCTTCGCGGG + Intergenic
942278664 2:174340733-174340755 CGGGGAACCTTGACCTGAGCGGG + Intergenic
946982125 2:225229512-225229534 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
947542289 2:230987409-230987431 CGGTGACGCTCAGCCAGCGCCGG + Intergenic
947962083 2:234247971-234247993 CGGGGAGGCTCGGGCAGCGCAGG - Intergenic
948445299 2:238027915-238027937 CAGGGACCCTTCGCCTGCTCTGG + Intronic
948467439 2:238159075-238159097 CGGGGACCCCAGGCCCGCGGCGG - Exonic
948641744 2:239379537-239379559 CAGGTCCCCTCGGCCTGAGCTGG + Intronic
948645622 2:239401826-239401848 CGGGCTCCCTCCGCCTGAGCAGG - Exonic
1169220632 20:3820398-3820420 CTTGGACCCTCGGCGTGGGCTGG - Intergenic
1171272157 20:23825740-23825762 CTGGGACCCTCACCCTGCACGGG - Intronic
1172271452 20:33657800-33657822 CCGGGGCCCTCGGCGTGTGCAGG + Exonic
1172773136 20:37393037-37393059 CGGGTCCCCTGGGCCTGGGCGGG - Intronic
1174059030 20:47819356-47819378 CAGGGACCCTCGGCCAGCTCAGG + Intergenic
1176184532 20:63771154-63771176 CGGGGACCCTCGCCCAGCCGAGG + Intronic
1176380491 21:6110334-6110356 CTGGGACCCTCTTCCCGCGCGGG - Intergenic
1176411302 21:6450866-6450888 CGGAGACCCGCTGCCTGTGCTGG - Intergenic
1178585605 21:33868380-33868402 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1178983311 21:37283248-37283270 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1179490846 21:41740808-41740830 CGTGGACCCCCGGTCTCCGCAGG + Exonic
1179686795 21:43059188-43059210 CGGAGACCCGCTGCCTGTGCTGG - Intronic
1179742981 21:43427906-43427928 CTGGGACCCTCTTCCCGCGCGGG + Intergenic
1180161519 21:46000542-46000564 CGGGGACTCTCAGCCTGTGCGGG - Intronic
1181102827 22:20552861-20552883 TGGGGACCCTGGGCCTACTCTGG - Intronic
1181672736 22:24433291-24433313 CTGGGCCCCTCCGCCTGGGCCGG + Exonic
1182337998 22:29598128-29598150 CGGGGAGGCTCCGGCTGCGCAGG + Intergenic
1183422077 22:37717902-37717924 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1183639580 22:39084815-39084837 CAGGGCCCCTCGGCCTGGCCTGG - Intronic
1183990395 22:41593816-41593838 CGGGGAGGCTCTGTCTGCGCAGG - Intergenic
1184645221 22:45891580-45891602 CGGGGCCCCTGGGCTGGCGCAGG - Intergenic
1184877298 22:47283834-47283856 GGGGGACCCTGGGCCGGGGCAGG + Intergenic
1185229078 22:49670264-49670286 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1185336284 22:50272092-50272114 CGGGAACCCCCTGCCTGCCCAGG + Intergenic
949260520 3:2098912-2098934 CCGGGCCCCTCGGACTGTGCCGG + Intronic
949522357 3:4868621-4868643 GCGGGACCCTCGGCTGGCGCGGG + Intronic
949709968 3:6861554-6861576 CTGGGACCCTTGGCGTGCACGGG - Exonic
951756481 3:26096620-26096642 CGGGGACCCTGGGCCTGGCCTGG + Intergenic
952393753 3:32903091-32903113 CGGGGAAGCTCGGGCTGCACAGG - Intergenic
954028776 3:47803359-47803381 CGGGCATCCTAGGCCTGCCCGGG + Intronic
955449521 3:59051155-59051177 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
955971999 3:64445447-64445469 CGGGCACCCTCGGCGGCCGCTGG + Intronic
956632639 3:71331395-71331417 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
961460504 3:127046975-127046997 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
961539574 3:127590490-127590512 CGGAGTCCCGCGGCCTGTGCTGG - Exonic
961956996 3:130814872-130814894 CGGGGAGGCTCGGGCTGCGCGGG + Intergenic
962398713 3:135039491-135039513 CGGGGAGGCTCGGGCTGCACAGG + Intronic
964198184 3:154088269-154088291 CGGGGAGACTTGGGCTGCGCAGG - Intergenic
964943557 3:162190654-162190676 CGGGGACCCTGGGCCAGCTCAGG - Intergenic
965648303 3:170908199-170908221 CGGGGACCTGCGGCCTGGGCTGG - Intronic
968512799 4:1002906-1002928 CGGTGACCCTGCGGCTGCGCGGG + Exonic
968519809 4:1030208-1030230 CTGGGCCCCTCGGGCTGGGCTGG + Intergenic
968820053 4:2843672-2843694 GCGGGACCCTGGGCCTCCGCAGG + Intergenic
969259695 4:6025492-6025514 AGGGGGCCCTCAGCCTGGGCTGG + Intergenic
969523621 4:7693050-7693072 CCGGCACCCTCGGCCAGGGCTGG - Intronic
972022748 4:34335703-34335725 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
976406421 4:84664989-84665011 CGGGGAGGCTCGGGCTGCACGGG - Intergenic
976520588 4:86021669-86021691 CGGGGAGGCTCGGGCTGCACAGG + Intronic
977906519 4:102483424-102483446 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
980051888 4:128047621-128047643 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
984241802 4:177227627-177227649 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
984662290 4:182386848-182386870 CGGGGAGGCTCGGGCTGCACAGG - Intronic
985195072 4:187420684-187420706 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
985412068 4:189695754-189695776 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
985564616 5:609062-609084 TGGGGACCCCAGGCCTGTGCGGG + Intergenic
985590923 5:764657-764679 TGGGGAGGCTCGGGCTGCGCAGG - Intronic
987132470 5:14872028-14872050 CGCGGAGCCTCGGCCGGCCCGGG + Intergenic
987383968 5:17311835-17311857 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
987990209 5:25200085-25200107 CGGGGAGGCTCGGGCTGCGCAGG + Intergenic
990490108 5:56295623-56295645 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
994254754 5:97580056-97580078 CGGGGAGGCTCGGGCTGCTCAGG + Intergenic
995679830 5:114704350-114704372 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
997282154 5:132656154-132656176 CGGGGTCCCTCGGCCTGACATGG + Intergenic
1000329146 5:160193958-160193980 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1000609177 5:163356112-163356134 TGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1000889288 5:166784603-166784625 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1002046440 5:176543953-176543975 CCGGGACCCGCGGCCTGAGCTGG - Intronic
1002221786 5:177688533-177688555 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1002399683 5:178984673-178984695 CGGAGACCCTGGGCCTGACCAGG + Intronic
1002454309 5:179337632-179337654 CTGGGACCCTGGGTCTGTGCTGG - Intronic
1003531417 6:6940388-6940410 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1004053109 6:12108451-12108473 CGGGGAGGCTTGGGCTGCGCAGG + Intronic
1004663354 6:17729053-17729075 CGGGGAGGCTCGGGCCGCGCAGG - Intergenic
1005707404 6:28469415-28469437 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1005712046 6:28512085-28512107 CGGGGAGGCTCGGGCCGCGCAGG - Intronic
1005749039 6:28866545-28866567 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1005758853 6:28949855-28949877 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1005835970 6:29709928-29709950 CTGGGACCCTGGCCCTGTGCAGG + Intergenic
1006055310 6:31379545-31379567 CTGGGACCCTGGCCCTGTGCAGG - Intergenic
1008844877 6:55950606-55950628 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1009510770 6:64547787-64547809 CGGGGCGGCTCGGGCTGCGCAGG + Intronic
1009800754 6:68533689-68533711 CGGGGAGGCTCGGGCTGTGCAGG - Intergenic
1010244860 6:73653695-73653717 CGGGTACCCGCACCCTGCGCCGG - Intronic
1012851027 6:104446586-104446608 CGGGGAGGCTGGGCCCGCGCAGG - Intergenic
1014586343 6:123202256-123202278 TGGGGAGGCTCGGGCTGCGCGGG - Intergenic
1015600390 6:134905029-134905051 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1017716839 6:157218828-157218850 CCGGGGCCCTCGGTCTGGGCAGG - Intergenic
1017839453 6:158209812-158209834 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1017927432 6:158922451-158922473 GGGGCACCCCCTGCCTGCGCAGG + Intergenic
1018624603 6:165765348-165765370 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1018997548 6:168721647-168721669 CGGGGACCCTGGGTGTGCCCTGG - Intergenic
1019322718 7:422933-422955 TGGGGACACTGGGCCTGCGGGGG - Intergenic
1019399525 7:844269-844291 CTGGGACCCTCGGCCGGGCCGGG + Intronic
1019534754 7:1523207-1523229 CGGGGGACCTCTGCCTGTGCAGG - Intergenic
1019563580 7:1669360-1669382 CGGGGACGCGCGGGCTGCGCGGG + Intergenic
1020008316 7:4793785-4793807 TGGGGAGGCTCGGACTGCGCAGG - Intronic
1020022818 7:4879156-4879178 CGGGCACCCGCGGCCTGTGGTGG - Intronic
1020085266 7:5307011-5307033 CAGGGACCCTGGGCTTGGGCCGG + Exonic
1020125316 7:5530041-5530063 CGGGGTGCCGCGGCCTGGGCTGG - Intronic
1020163956 7:5793792-5793814 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1022114651 7:27251561-27251583 CGGGGACCCTCGGCCTCACCTGG - Intergenic
1024579932 7:50793280-50793302 CGGGGACCCGCGCCCGCCGCCGG - Intronic
1024691326 7:51806133-51806155 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1025235880 7:57234670-57234692 CAGGGACCCTCGGCCAGCTCAGG - Intergenic
1026202991 7:68231331-68231353 CGGGGAGCCTCGGGCTGCACAGG - Intergenic
1026335935 7:69394125-69394147 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1027778990 7:82499869-82499891 CGGGGAGGCTCGGGCTGTGCAGG - Intergenic
1029567549 7:101348874-101348896 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1030102095 7:105955871-105955893 CGGGGAGGCTCAGGCTGCGCAGG + Intronic
1031056491 7:116998058-116998080 CGGGGATGCTCGGGCTGCACAGG + Intronic
1031605495 7:123763277-123763299 CAGGGAGGCTCGGGCTGCGCAGG + Intergenic
1032480057 7:132239097-132239119 AGGGGGCCCTCAGCCTGCACGGG - Intronic
1035833949 8:2728096-2728118 GGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1040003652 8:42600118-42600140 CGGGGAGGCTCGGGCTGCACGGG + Intergenic
1041636627 8:60153029-60153051 CGGGGAGGCTCGGGCTGCGCAGG + Intergenic
1042512530 8:69626546-69626568 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1042556068 8:70034754-70034776 GCGGGACCCTCGGCCTCTGCCGG + Intergenic
1042560642 8:70070466-70070488 CGGGGTCCCTGGACCTGCCCGGG - Intronic
1042948719 8:74179593-74179615 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1043110142 8:76169869-76169891 CGGGGATGCTCGGGCTGCACAGG - Intergenic
1043435366 8:80232106-80232128 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1045467721 8:102485575-102485597 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1045738107 8:105319257-105319279 CGGGGACTCGCAGCGTGCGCGGG - Intronic
1045743304 8:105387393-105387415 CGGGGAGGCTCCGGCTGCGCAGG + Intronic
1047253759 8:123200438-123200460 GGGGGGCCCTCGCCCTGGGCAGG + Intronic
1049087596 8:140490577-140490599 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1049441590 8:142612176-142612198 CTGGGACCCTCCGCCTGCCATGG + Exonic
1049615401 8:143573708-143573730 CTGGGCCCCTCGGAGTGCGCGGG + Intergenic
1051463837 9:17354233-17354255 CGGGGAGGCTCGGGCTGCACAGG - Intronic
1053547874 9:39042419-39042441 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1055651412 9:78410293-78410315 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1055654977 9:78442372-78442394 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1057300738 9:93880202-93880224 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1057511172 9:95680629-95680651 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1058786536 9:108393812-108393834 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1059634068 9:116154836-116154858 CGCGGACCCTCGGCCAGTGAGGG + Intronic
1060283457 9:122228745-122228767 CGGGGAACCTCGGGCTCAGCGGG + Exonic
1060583280 9:124770775-124770797 CGCGGACCCTCCCCCTGCCCGGG - Intronic
1060829163 9:126702962-126702984 CCGGGACCCTGGGCCTGACCTGG - Intergenic
1061580046 9:131530972-131530994 GGGGGCCCCTCGGCCGGGGCTGG + Intronic
1061864300 9:133484687-133484709 GGGGGACCCTGGGTCTGCTCTGG + Intergenic
1061920263 9:133778726-133778748 CGGGGACCCTCGACCCTCCCGGG + Intronic
1062146172 9:134991095-134991117 CGGGGAAGCTCGGGCTGCACAGG + Intergenic
1062268644 9:135699037-135699059 CTGGGACCCTCGGCCACCGTAGG + Exonic
1062382339 9:136292457-136292479 GCGGGACCCTCAGCCTGCACAGG + Intronic
1062729144 9:138098899-138098921 CTGGGCCCCTCGGCCTGTCCTGG - Intronic
1203670526 Un_KI270755v1:7227-7249 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1188112039 X:26205057-26205079 CGGGGAGACTCGGGCTGCACAGG - Intergenic
1188189566 X:27157301-27157323 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1190413927 X:50163393-50163415 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1193271104 X:79530881-79530903 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1193804001 X:85972421-85972443 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1194890451 X:99372134-99372156 CGGGGAGGCTCAGGCTGCGCAGG + Intergenic
1196705873 X:118716999-118717021 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1196775550 X:119333893-119333915 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1197331138 X:125155531-125155553 CGGGGAGACTCGGGCTGCACAGG + Intergenic
1197340089 X:125255945-125255967 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1198872274 X:141188601-141188623 CAGGGAGGCTCGGCCTGCACAGG + Intergenic
1199175576 X:144783916-144783938 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1199285060 X:146046248-146046270 CGGGGAGGCTCAGACTGCGCAGG + Intergenic
1201487105 Y:14505948-14505970 CGGGGAGGCTCGGGCTGCACAGG - Intergenic