ID: 1132482219

View in Genome Browser
Species Human (GRCh38)
Location 16:172475-172497
Sequence CGCCCCGGCCTGGCACGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132482219_1132482230 18 Left 1132482219 16:172475-172497 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132482230 16:172516-172538 CTCCCTCGCTAGGGACGCTCCGG No data
1132482219_1132482233 29 Left 1132482219 16:172475-172497 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132482233 16:172527-172549 GGGACGCTCCGGCGCCCGAAAGG No data
1132482219_1132482228 8 Left 1132482219 16:172475-172497 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132482228 16:172506-172528 GGCTGACTTTCTCCCTCGCTAGG No data
1132482219_1132482229 9 Left 1132482219 16:172475-172497 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132482229 16:172507-172529 GCTGACTTTCTCCCTCGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132482219 Original CRISPR CGCCCCGGCCTGGCACGCGC TGG (reversed) Intergenic
No off target data available for this crispr