ID: 1132483067

View in Genome Browser
Species Human (GRCh38)
Location 16:176279-176301
Sequence CGCCCCGGCCTGGCACGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132483067_1132483076 8 Left 1132483067 16:176279-176301 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132483076 16:176310-176332 GGCTGACTTTCTCCCTCGCTAGG No data
1132483067_1132483081 29 Left 1132483067 16:176279-176301 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132483081 16:176331-176353 GGGACGCTCCGGCGCCCGAAAGG No data
1132483067_1132483077 9 Left 1132483067 16:176279-176301 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132483077 16:176311-176333 GCTGACTTTCTCCCTCGCTAGGG No data
1132483067_1132483078 18 Left 1132483067 16:176279-176301 CCAGCGCGTGCCAGGCCGGGGCG No data
Right 1132483078 16:176320-176342 CTCCCTCGCTAGGGACGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132483067 Original CRISPR CGCCCCGGCCTGGCACGCGC TGG (reversed) Intergenic
No off target data available for this crispr