ID: 1132484130

View in Genome Browser
Species Human (GRCh38)
Location 16:181394-181416
Sequence CGTCCTCGCAGCCCGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132484130_1132484135 3 Left 1132484130 16:181394-181416 CCGGGCGGCGGGCTGCGAGGACG No data
Right 1132484135 16:181420-181442 GACTCTGCCCATCCCGAGGGCGG No data
1132484130_1132484136 7 Left 1132484130 16:181394-181416 CCGGGCGGCGGGCTGCGAGGACG No data
Right 1132484136 16:181424-181446 CTGCCCATCCCGAGGGCGGCTGG No data
1132484130_1132484133 0 Left 1132484130 16:181394-181416 CCGGGCGGCGGGCTGCGAGGACG No data
Right 1132484133 16:181417-181439 GCCGACTCTGCCCATCCCGAGGG No data
1132484130_1132484132 -1 Left 1132484130 16:181394-181416 CCGGGCGGCGGGCTGCGAGGACG No data
Right 1132484132 16:181416-181438 GGCCGACTCTGCCCATCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132484130 Original CRISPR CGTCCTCGCAGCCCGCCGCC CGG (reversed) Intergenic
No off target data available for this crispr