ID: 1132485347

View in Genome Browser
Species Human (GRCh38)
Location 16:187432-187454
Sequence TGCCACAGGCTGTCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132485347_1132485350 -5 Left 1132485347 16:187432-187454 CCTGGAGGGGACAGCCTGTGGCA No data
Right 1132485350 16:187450-187472 TGGCAGGAGAGCCCAGAGCAAGG No data
1132485347_1132485356 22 Left 1132485347 16:187432-187454 CCTGGAGGGGACAGCCTGTGGCA No data
Right 1132485356 16:187477-187499 CAGCTACACTGTGATACCGGTGG No data
1132485347_1132485354 19 Left 1132485347 16:187432-187454 CCTGGAGGGGACAGCCTGTGGCA No data
Right 1132485354 16:187474-187496 CACCAGCTACACTGTGATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132485347 Original CRISPR TGCCACAGGCTGTCCCCTCC AGG (reversed) Intergenic
No off target data available for this crispr