ID: 1132490654

View in Genome Browser
Species Human (GRCh38)
Location 16:228913-228935
Sequence CCAGGTCGCTGGCAGCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132490654_1132490670 26 Left 1132490654 16:228913-228935 CCACCCGGCTGCCAGCGACCTGG 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1132490670 16:228962-228984 CGACTCCACAGTTCGCGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1132490654_1132490669 25 Left 1132490654 16:228913-228935 CCACCCGGCTGCCAGCGACCTGG 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1132490669 16:228961-228983 CCGACTCCACAGTTCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 24
1132490654_1132490665 21 Left 1132490654 16:228913-228935 CCACCCGGCTGCCAGCGACCTGG 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1132490665 16:228957-228979 TCCGCCGACTCCACAGTTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1132490654_1132490667 24 Left 1132490654 16:228913-228935 CCACCCGGCTGCCAGCGACCTGG 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1132490667 16:228960-228982 GCCGACTCCACAGTTCGCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132490654 Original CRISPR CCAGGTCGCTGGCAGCCGGG TGG (reversed) Intronic
900403260 1:2481482-2481504 CCAGGGCCCGGGCAGCAGGGTGG + Intronic
900619340 1:3579836-3579858 CGGGGTCCCTGGAAGCCGGGGGG + Exonic
900681236 1:3917924-3917946 CCAGGTGGCTGGAATCTGGGAGG - Intergenic
902154923 1:14477577-14477599 CCAAGTGGCTGGCAGCCCCGAGG - Intergenic
902878399 1:19354735-19354757 CCAGGTCACTGTAAACCGGGTGG + Intronic
903413981 1:23168808-23168830 GCCGGTCGCTGGCAGCTGAGCGG - Exonic
903857468 1:26345442-26345464 GCAGGACGGTGGCAGCAGGGGGG + Exonic
904271732 1:29354648-29354670 GCAGGTAGCTGGGAGCCGTGAGG - Intergenic
905626296 1:39492188-39492210 CGCGGACGCGGGCAGCCGGGAGG - Exonic
905670601 1:39788267-39788289 CGCGGACGCGGGCAGCCGGGAGG + Exonic
905914351 1:41674667-41674689 CCTGGTGGCCGGCAGCCGGGTGG - Intronic
906242188 1:44248901-44248923 GGAGGTTGCTGGCAGCCAGGTGG - Intronic
906288324 1:44602930-44602952 GCAGGGAGCAGGCAGCCGGGCGG - Intronic
906658950 1:47568971-47568993 CCATGTGGATGGCAGGCGGGAGG - Intergenic
911126196 1:94343335-94343357 CCAGGTAGGTAGCAGCCGTGAGG - Intergenic
916047718 1:161013257-161013279 CCAGCTCCCTGGCAACTGGGGGG - Intronic
916108688 1:161448053-161448075 CTTGGTCGCCCGCAGCCGGGCGG - Intergenic
916110276 1:161455434-161455456 CTTGGTCGCCCGCAGCCGGGCGG - Intergenic
916111861 1:161462844-161462866 CTTGGTCGCCCGCAGCCGGGCGG - Intergenic
916113448 1:161470225-161470247 CTTGGTCGCCCGCAGCCGGGCGG - Intergenic
919112848 1:193241841-193241863 CCAGGTCGCAGGCAGGGGTGGGG + Intronic
919744872 1:201002423-201002445 CCAGGGCGCTGGCAGAGGGAGGG - Intronic
920333312 1:205227915-205227937 CCCGGGCGGAGGCAGCCGGGCGG + Intergenic
922222810 1:223621404-223621426 CCCGCTCCCTGGCAGGCGGGAGG - Intronic
922465738 1:225844806-225844828 CCAGGTGCCTGGCTCCCGGGCGG + Intronic
922572739 1:226643478-226643500 CCAGGTGGAGGGCAGGCGGGCGG - Intronic
1063663629 10:8049627-8049649 ACAGCTCGCCGGCTGCCGGGCGG - Intergenic
1066298316 10:34075438-34075460 CCAGGTCCCTGGGAGGCTGGAGG - Intergenic
1067815931 10:49476887-49476909 CCAGGTAGGTGGCAGAGGGGTGG - Intronic
1068758819 10:60684329-60684351 CCTGTTCGCTGGCACCAGGGAGG - Intronic
1069684472 10:70308883-70308905 CCAGGCTGCTGGCAGCTGTGTGG - Intronic
1070326856 10:75395421-75395443 CCAGCGCGCGGGCAGCCGGCTGG - Intergenic
1070467814 10:76742222-76742244 CCAGGTAGCAGGCAGCTGTGTGG + Intergenic
1071530941 10:86389949-86389971 CTCGGGCGCTGTCAGCCGGGTGG - Intergenic
1072637043 10:97185159-97185181 CCAGTTCGCAGGCACCCTGGAGG + Intronic
1074049318 10:109867833-109867855 CCAGGAAGCTGGAAGCCAGGAGG - Intronic
1076046839 10:127300909-127300931 CCACGAGGCCGGCAGCCGGGAGG + Intronic
1076875392 10:133213287-133213309 GCAGGGCCCTGGCAGCTGGGTGG - Intronic
1077343815 11:2037407-2037429 ACAGGTCCCAGGCAGCCGAGGGG + Intergenic
1079313484 11:19387615-19387637 CCAGGTCGCAGGCAGCACTGGGG + Intronic
1080592888 11:33738794-33738816 CCAGGTCTCTAGCAGCCGTGTGG - Intergenic
1081705546 11:45180590-45180612 GCAGTTGGCTGGCGGCCGGGAGG - Intronic
1082160664 11:48884946-48884968 CCAGGTCTCTGGCAGCCCACCGG + Intergenic
1082161702 11:48895460-48895482 CCAGGTCTCTGGCAGCCCACCGG - Intergenic
1082656898 11:55867838-55867860 CCAGGTCTCTGGCAGCCCACCGG - Intergenic
1082786778 11:57321746-57321768 CCAGGTGGCTGGGAGGGGGGTGG - Intronic
1083616977 11:64031135-64031157 CCAGGCCACTGGCACCGGGGAGG - Intronic
1083779931 11:64912484-64912506 CCAGGGCGAGGGCAGGCGGGTGG - Intronic
1083856242 11:65394402-65394424 TCAGGTCGCAGGCTGCCGGCCGG - Exonic
1084680540 11:70663827-70663849 CCAGGACCCTGGGAGCCTGGGGG + Intronic
1084692213 11:70734069-70734091 GGAGGTCCCTGGCAGCAGGGAGG + Intronic
1085414311 11:76310149-76310171 CCAGGGCGCTGGCAGCCCTCAGG - Intergenic
1085424683 11:76393568-76393590 CCAGGTGGATGGCAGCAGAGAGG - Intronic
1087130879 11:94668509-94668531 CCAGGGGGCTGGGGGCCGGGGGG - Intergenic
1090473913 11:127003315-127003337 TGAGGCCGCGGGCAGCCGGGCGG - Intronic
1091334251 11:134754601-134754623 CCAGGTGGGTGGAAGCCAGGTGG - Intergenic
1202826801 11_KI270721v1_random:92596-92618 ACAGGTCCCAGGCAGCCGAGGGG + Intergenic
1091798545 12:3310645-3310667 CCAGGCCGCTGGCAGCAGGGAGG + Intergenic
1092045536 12:5430042-5430064 CCAGGTCCCTGGCAGTCTGGAGG - Intergenic
1093435464 12:19130188-19130210 GCAGGTTGCGGGGAGCCGGGCGG - Intronic
1093949418 12:25147531-25147553 CCAGCTACCTGGCAGCTGGGAGG + Intronic
1096994340 12:55829603-55829625 CCAGGTCGCCGGCGGCCGCGGGG - Exonic
1100326178 12:93542093-93542115 CCAGGTCTCTGGCAGCAGGCAGG + Intergenic
1103241301 12:119415623-119415645 CCAGGTGGCTTGCAGCAGCGTGG + Intronic
1112342808 13:98566387-98566409 CCAGGGAGCAGGCAGTCGGGAGG + Intronic
1113917782 13:113884439-113884461 CGGGGGCGCCGGCAGCCGGGAGG + Intergenic
1114627929 14:24141476-24141498 CCAGGGCGCCGGGAGCCGGCGGG - Exonic
1121601011 14:95202960-95202982 CCTGGTCGCTGGCACTGGGGAGG + Exonic
1121733998 14:96205438-96205460 CCAGCTCGCTGGCTCCCTGGGGG + Intronic
1122270687 14:100567458-100567480 CCAGGCAACTGGCAGCCCGGGGG + Intronic
1122315699 14:100825032-100825054 ACAGGTGGGTGGCAGCCAGGAGG - Intergenic
1122887086 14:104714892-104714914 CCAGGGCGCTGGCACCCAGCCGG + Intronic
1123002021 14:105300879-105300901 CCAGCTCGCTCGCAGTGGGGAGG - Exonic
1123011379 14:105351089-105351111 CCAGGTGGCTGGAGGGCGGGCGG - Intronic
1123012216 14:105354954-105354976 CCTGGTCGCAGGCTGCAGGGTGG + Intronic
1125519741 15:40341037-40341059 CCAGGGCACTGGCAGCTGGCTGG + Intergenic
1128582153 15:68818133-68818155 GCGGGGCGCTGGCAGGCGGGCGG - Intronic
1128834258 15:70796564-70796586 CCATGCCGATGGCAGCCCGGGGG + Intergenic
1129725851 15:77901385-77901407 CCAGGTAGCTGGCACTCGGCGGG - Intergenic
1129820863 15:78601001-78601023 CCAGCCTGCTGGCAGCCTGGTGG + Intronic
1132381295 15:101368543-101368565 GCAGGTAGCAGGCAGGCGGGTGG - Intronic
1132405789 15:101541299-101541321 CCAGGACCCTGGGAGCCTGGAGG + Intergenic
1132490654 16:228913-228935 CCAGGTCGCTGGCAGCCGGGTGG - Intronic
1132906639 16:2285905-2285927 CAAGGTCGCCGGCAGCCGTGGGG - Intronic
1135634535 16:24062714-24062736 CCAGCACTCTGGCAGCCAGGAGG + Intronic
1136410843 16:30076173-30076195 CCAGGCCGTTGGACGCCGGGGGG + Intronic
1137037812 16:35581015-35581037 ACAGGCAGCTGGCAGCCTGGAGG + Intergenic
1138567834 16:57846355-57846377 CCAGGTTGGAGGCAGCCGGGAGG - Intronic
1139420117 16:66844736-66844758 CCAGGTCGCTTGCTGGCGGCGGG - Intronic
1139542764 16:67630877-67630899 CTAGGTTGCTGGCATCCAGGTGG + Intronic
1141805303 16:86337763-86337785 CCAGCTCGCTGGCTGCCGTGTGG + Intergenic
1142305213 16:89280748-89280770 CCAGGTAGCTGGGCTCCGGGGGG + Exonic
1142310534 16:89309910-89309932 CCAGGTGGCCGGCAGGCTGGTGG - Intronic
1142645183 17:1307124-1307146 CCAGGCCGATGGCAGGCGTGGGG + Intergenic
1142846808 17:2684836-2684858 GCAGGGCACTGGCAGCGGGGAGG - Exonic
1144670292 17:17129001-17129023 CCAGGCAGCTGGGAGCTGGGTGG + Intronic
1148094471 17:45042798-45042820 CCAGGTAACTGGCAGCCTGGAGG - Intronic
1148805433 17:50261458-50261480 CCAGGCCAGTGGCAGCCAGGTGG + Intergenic
1150459299 17:65333891-65333913 CCAGGAGGCTGGCAGCATGGTGG + Intergenic
1152071690 17:78137355-78137377 TCAGGTGGCTGGCAGCCCGGCGG + Exonic
1152711318 17:81871584-81871606 CCAGGGCGCCCGCACCCGGGAGG + Intergenic
1153765120 18:8367402-8367424 CCGGGTCGGAGGCATCCGGGCGG + Intronic
1154173417 18:12067142-12067164 CCAGGGCGGTGTCAGGCGGGAGG - Intergenic
1155234537 18:23806182-23806204 CCAGGTTGGTGGCAGCCAAGTGG - Intronic
1155947790 18:31876196-31876218 CAAGATCGCTTACAGCCGGGAGG + Intronic
1156008467 18:32470546-32470568 TCCGGCCGCGGGCAGCCGGGGGG + Intergenic
1157599639 18:48886043-48886065 CCAGGCCCCGGGCAGCCGCGGGG + Intergenic
1158213953 18:55079817-55079839 CCAGGTGGTTGTCAGCTGGGAGG + Intergenic
1160680195 19:408796-408818 ACAGGTGGGTGGGAGCCGGGGGG - Intronic
1160915177 19:1492966-1492988 CCAGGAGGCAGGCAGCAGGGAGG + Intronic
1161105754 19:2443232-2443254 CCAGGCCCCGGGCAGGCGGGCGG + Intronic
1161538018 19:4831717-4831739 CCAGGGCGCGGGCCGCGGGGTGG - Intergenic
1166330680 19:42076427-42076449 CCGGCGCGCGGGCAGCCGGGCGG + Intronic
1166939447 19:46353926-46353948 CCATGTTGCTGGCAGCCCGGCGG - Exonic
1167134921 19:47610169-47610191 CCAGGCCGCGGGCACCCGGAGGG + Intronic
925155344 2:1644676-1644698 CCTGGTGCCTGGCAGCCGGCTGG - Exonic
927697234 2:25246758-25246780 CCAGGTGGCCAGCAGCCGCGCGG - Exonic
933354618 2:81196488-81196510 CCAGGTAGCTGGGCTCCGGGGGG + Intergenic
935805712 2:106745712-106745734 CCAGGTTGCTGGCAGGCTAGGGG + Intergenic
936376912 2:111948698-111948720 CCAGGGTGCTGGCAGCAGGGTGG - Intronic
942678301 2:178451091-178451113 CCGGGTCGCTGGTCCCCGGGAGG + Exonic
1176124617 20:63469903-63469925 CCAGGGGTCTGGGAGCCGGGCGG + Intronic
1176187936 20:63791691-63791713 CCAGGGCGCTGGCAGCCGCAGGG - Intronic
1180136931 21:45868004-45868026 ACAGGAGGCTGGCAGCCAGGGGG + Intronic
1181077918 22:20393800-20393822 CCACGTAGCTGGGAGTCGGGTGG - Intergenic
1182583132 22:31327232-31327254 TCAGGTCGCTGGCATCTGAGAGG + Exonic
1183197107 22:36361115-36361137 CCTGGGCACTGGCAGCTGGGAGG - Intronic
1183309829 22:37103375-37103397 CCAGGTGGCTGGCGGGCAGGGGG - Exonic
1183352852 22:37343632-37343654 GCTGGTGGCTGGCAGCCTGGTGG - Intergenic
1183805846 22:40210154-40210176 CGAGGTCTCTAGCAGCCTGGGGG - Intronic
1184096415 22:42318679-42318701 CCAGGTCACCTGCAGCCTGGTGG - Intronic
1184786822 22:46676085-46676107 CCAGGACGCTCGGAGCTGGGAGG - Intronic
1184790278 22:46695838-46695860 CCAGGCTGCTGGCAGCCCCGTGG - Intronic
950651996 3:14413068-14413090 CCAGGCTGCTGACAGCAGGGCGG + Intronic
952354247 3:32570297-32570319 CCGGGCCGCTGGGGGCCGGGCGG + Intronic
952644432 3:35639076-35639098 CCTGCTCGCTGGGAGCAGGGAGG + Intronic
953996618 3:47524685-47524707 ACCGGTAGCTGGGAGCCGGGTGG - Intergenic
954004180 3:47578723-47578745 CGAGGGCGCAGCCAGCCGGGCGG - Exonic
954698814 3:52441278-52441300 CCATGTCACTGTCAGCCGCGTGG - Exonic
955489426 3:59467679-59467701 CCAGCTGGCTGGCAGCTGGCTGG - Intergenic
960296230 3:115947886-115947908 CCAGGTAGCTGGCTGATGGGAGG + Intronic
960960873 3:123069208-123069230 CCAGGTTCCTGGAAGCCGGTTGG + Intronic
961202567 3:125056115-125056137 GCGGGTCGCTGGCTGGCGGGCGG + Intergenic
964282331 3:155080054-155080076 CCAGGGCGCTGGGAGCCCGTGGG + Intronic
967854378 3:194105485-194105507 CAAGGTCCCTGAGAGCCGGGTGG - Intergenic
967857767 3:194131184-194131206 CCACGTCTCTGGCAGGCTGGAGG + Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968434286 4:576679-576701 CCCGGCCGCTGGCAGGCGGGTGG - Intergenic
968518339 4:1024113-1024135 CCCGGGCGCTGGCGGGCGGGGGG + Intronic
969402883 4:6968657-6968679 CCAGGAGGCTGACCGCCGGGAGG + Intronic
969585123 4:8087211-8087233 CCAGGTGCCTGGCAGCGGCGGGG + Intronic
969716709 4:8871485-8871507 CCAGGGCGACGGCAGCCGGGAGG - Exonic
981603966 4:146522627-146522649 CCAGGTCGCTCGCCTGCGGGTGG + Intergenic
984714977 4:182917208-182917230 GCGGGGCGCTGGCTGCCGGGCGG - Intronic
985781849 5:1875730-1875752 CCCGGCCGCGGGCAGCCTGGCGG - Intergenic
997228684 5:132227934-132227956 CCAGGACGCAGGCAGGCGTGTGG - Intronic
997926059 5:138032559-138032581 CCGTGTCCCTGGCTGCCGGGGGG - Intronic
999253626 5:150196985-150197007 CAAGCTCTCTGCCAGCCGGGTGG - Intronic
1000152926 5:158520778-158520800 CCAGCTCTCTGGAAGCAGGGAGG - Intergenic
1001934665 5:175695650-175695672 CGATGTCGCTGGCAGCAGGGAGG - Intergenic
1006470032 6:34223606-34223628 CCAGCTCTGTGGCAGCCGGCAGG - Intergenic
1006625292 6:35393205-35393227 CCAGGGCTCTGGCAGCCAAGTGG + Intronic
1010254088 6:73738354-73738376 ACAGGTGGCTGGCAGCCTGTGGG + Intronic
1011734315 6:90296544-90296566 CCACCTCGCCGGCTGCCGGGAGG - Exonic
1013803428 6:113971351-113971373 CCAGGGAGCGTGCAGCCGGGTGG + Intronic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1019501976 7:1369188-1369210 CCTGGTCGCTCGGAGCCGCGCGG - Intergenic
1019610817 7:1935845-1935867 GGAGGGGGCTGGCAGCCGGGTGG + Intronic
1020907317 7:14079555-14079577 GCAGGTCGCTTGAACCCGGGAGG + Intergenic
1021958749 7:25852401-25852423 CCAGGCCCCGGGCAGGCGGGCGG + Intergenic
1024987431 7:55207592-55207614 CCAGGTCTCAGTCAGCGGGGAGG + Exonic
1025734522 7:64135278-64135300 CCAGGCAGCTGGGAGCCTGGGGG + Intronic
1026873813 7:73868742-73868764 CAAGGTCTCTGGCATCCTGGGGG + Intergenic
1026979808 7:74519634-74519656 CCAGGTCGCTGGGGGCAAGGGGG - Exonic
1033257610 7:139815791-139815813 CCTGGTCACTGGCTGCCTGGGGG - Intronic
1034414560 7:150957733-150957755 CCAGGACGCTGGCAGGCAGGGGG + Intronic
1037878777 8:22562442-22562464 CCAGGGCCCCAGCAGCCGGGCGG - Intronic
1038404471 8:27311288-27311310 CGCGGGCGTTGGCAGCCGGGCGG - Exonic
1049431232 8:142566225-142566247 GCAGGTGGCTTGCAGCCGAGGGG + Intergenic
1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG + Exonic
1049557291 8:143289434-143289456 CCTCCTCGCTGGCAGCCGGCAGG - Intergenic
1049664488 8:143836910-143836932 TCTGGTCTCTGGCAGCCAGGAGG + Intronic
1049776620 8:144408972-144408994 CCACGTCGCGGACAGCCGGGAGG + Intronic
1053435345 9:38069974-38069996 CCTGTTCGCTGCCAGCCGGCGGG + Intergenic
1057236533 9:93366065-93366087 CCAGGTGGCCGGCAGCCATGGGG + Intergenic
1059384087 9:113950656-113950678 CCAGGCCGAGGGCAGCCTGGAGG - Intronic
1060553749 9:124498002-124498024 CCAGGAAGCTGCCAGCCTGGAGG - Intronic
1060961669 9:127685035-127685057 CCAGGTCAGTGGCAGCTGGACGG + Intronic
1062110312 9:134778659-134778681 ACAGGGCGGAGGCAGCCGGGAGG - Intronic
1062268507 9:135698409-135698431 CCAGTTCGATGGCCGGCGGGAGG - Exonic
1062268608 9:135698897-135698919 CCAGGTGTCAGGCAGCTGGGAGG - Intronic
1062478581 9:136741406-136741428 CTCGGTGGCTGGCAGGCGGGAGG - Intronic
1188651115 X:32632717-32632739 CCAGGACGCTGGGTGCGGGGGGG + Intronic
1190825948 X:54017996-54018018 CCAGGTCACTGGCAGAGGTGGGG + Intronic
1192455163 X:71270044-71270066 CCAGATGGGTGGCAGCTGGGCGG + Intergenic
1198388118 X:136147667-136147689 CCAGGACGCCGGCGGGCGGGAGG - Intronic
1200151536 X:153953744-153953766 CCTGATCGCTGGCAGCAGGTGGG + Exonic