ID: 1132491501

View in Genome Browser
Species Human (GRCh38)
Location 16:234431-234453
Sequence TTGACCACGAGGAGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132491501_1132491510 14 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491510 16:234468-234490 GGGGAGAGCACCCGGAAGCGGGG 0: 1
1: 1
2: 1
3: 6
4: 144
1132491501_1132491504 -7 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491504 16:234447-234469 TGGTCAAAGAGGAGAAACACTGG 0: 1
1: 0
2: 0
3: 31
4: 342
1132491501_1132491506 -5 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491506 16:234449-234471 GTCAAAGAGGAGAAACACTGGGG 0: 1
1: 0
2: 0
3: 33
4: 303
1132491501_1132491505 -6 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491505 16:234448-234470 GGTCAAAGAGGAGAAACACTGGG 0: 1
1: 0
2: 1
3: 25
4: 272
1132491501_1132491511 15 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491511 16:234469-234491 GGGAGAGCACCCGGAAGCGGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
1132491501_1132491508 12 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491508 16:234466-234488 CTGGGGAGAGCACCCGGAAGCGG 0: 1
1: 0
2: 2
3: 17
4: 213
1132491501_1132491507 6 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491507 16:234460-234482 GAAACACTGGGGAGAGCACCCGG 0: 1
1: 0
2: 0
3: 19
4: 237
1132491501_1132491509 13 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491509 16:234467-234489 TGGGGAGAGCACCCGGAAGCGGG 0: 1
1: 2
2: 0
3: 9
4: 219
1132491501_1132491512 20 Left 1132491501 16:234431-234453 CCAGCAATTCTCCTCGTGGTCAA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132491512 16:234474-234496 AGCACCCGGAAGCGGGGGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132491501 Original CRISPR TTGACCACGAGGAGAATTGC TGG (reversed) Intergenic
901494355 1:9612827-9612849 TTGGCCAAGAGAAGAATTGGGGG + Intronic
901731309 1:11282100-11282122 ATGCCCAGGAGTAGAATTGCTGG + Intronic
901944074 1:12686749-12686771 TTGCCCAAGAGGGCAATTGCTGG - Intergenic
909187736 1:72510531-72510553 TTGGACAGGAGGAGAATTCCAGG - Intergenic
910676679 1:89821995-89822017 TTGAAAAGGAGGAGAATTGGGGG + Intronic
912482717 1:109996259-109996281 TTGATCACGAGGAGAAATCTTGG + Intronic
914686478 1:149984327-149984349 TTGAGGACAAGGAGATTTGCAGG - Intronic
915084787 1:153378690-153378712 TGGACCAACAGGAGAGTTGCTGG + Intergenic
923136272 1:231122968-231122990 CTGACCATGTGGAGAATGGCTGG - Intergenic
923475028 1:234324123-234324145 TTGTGCAGGAGGGGAATTGCTGG + Exonic
923727219 1:236517052-236517074 TTGGCCACGTCGATAATTGCTGG + Intergenic
1065646753 10:27842860-27842882 ATGCCCAGGAGCAGAATTGCTGG - Intronic
1066304391 10:34125888-34125910 TTGCCAACAAGGAGACTTGCTGG - Intronic
1070160037 10:73860924-73860946 GTGACCACAAGGAGAATGGATGG - Intronic
1071081270 10:81814851-81814873 ATGACCAAGAGGTCAATTGCTGG - Intergenic
1075988894 10:126815797-126815819 ATGCCCACTAGGAGGATTGCTGG - Intergenic
1076547292 10:131253922-131253944 TTGACACCGAAGAGAATTGCCGG + Intronic
1094466470 12:30758704-30758726 TTGGCTACTAGGAGAAATGCTGG - Intergenic
1099899541 12:88691094-88691116 TTGACCATGAGGACAACAGCAGG + Intergenic
1100175683 12:92028402-92028424 AAGACCAAGAGGAGAAATGCTGG - Intronic
1101036527 12:100713048-100713070 CTGAGCACGAGGAGCATTGAGGG + Intergenic
1101403457 12:104408098-104408120 TTGACCACCAGGGGAAGTGTTGG + Intergenic
1104754882 12:131262737-131262759 TTGAACCCGTGGAGAACTGCGGG - Intergenic
1106133304 13:26956951-26956973 TTCTCCACGTGGAGAATTTCGGG - Intergenic
1107706485 13:43112036-43112058 TTGCCCACCAGCAAAATTGCTGG + Exonic
1108250274 13:48559983-48560005 TTGATCAAGAGTACAATTGCTGG - Intergenic
1111168129 13:84490432-84490454 TTTACCATGAGGTGAATTACTGG + Intergenic
1112884397 13:104151010-104151032 TTGAGAACCAGGAGAATTGATGG + Intergenic
1117210450 14:53492794-53492816 TTCATCCAGAGGAGAATTGCGGG + Intergenic
1117318655 14:54599144-54599166 TTTCCCAAGAGAAGAATTGCTGG + Intronic
1121485895 14:94314053-94314075 TTGACCAGGACGAGGATGGCTGG + Exonic
1122805836 14:104256395-104256417 ATGACTAGGAGTAGAATTGCTGG + Intergenic
1125700135 15:41675153-41675175 ATGTCTAGGAGGAGAATTGCTGG + Intronic
1126138933 15:45420343-45420365 TTAGCTACAAGGAGAATTGCTGG + Intronic
1127144387 15:56009542-56009564 TTCACCAAGAGTGGAATTGCTGG + Intergenic
1128473531 15:67976674-67976696 TGTACCAGGAGTAGAATTGCTGG + Intergenic
1132491501 16:234431-234453 TTGACCACGAGGAGAATTGCTGG - Intergenic
1133486281 16:6222475-6222497 ATGACCATGAGGAGAATGTCAGG + Intronic
1137477519 16:48822610-48822632 TTGAGCAGGAGTGGAATTGCTGG + Intergenic
1138717161 16:59036716-59036738 TTGAGCAGCAGGAGTATTGCAGG + Intergenic
1140729505 16:77843403-77843425 TTGACCCCCAGGAGAGATGCTGG + Intronic
1143221937 17:5269458-5269480 ATAACCAGGAGTAGAATTGCTGG - Intergenic
1149107864 17:52991130-52991152 TTCAACACAAGGAGAAATGCTGG + Intergenic
1152256052 17:79240066-79240088 ATGTCCTTGAGGAGAATTGCAGG - Intronic
1157478246 18:48036858-48036880 TTGGCCACAGGGAGAATTACAGG + Intronic
1159127446 18:64240601-64240623 TTGACCACTAGGACAATTACTGG + Intergenic
1160762189 19:791299-791321 ATGAATAGGAGGAGAATTGCGGG + Intergenic
1164842942 19:31407712-31407734 ATGTCCATGAGCAGAATTGCAGG + Intergenic
925111007 2:1337201-1337223 TTGAACAAGAGTAGAATTGCTGG + Intronic
925200839 2:1966532-1966554 ATGACCAGGAGGAGAATTGCTGG - Intronic
928226784 2:29456199-29456221 ATGCCCAGGAGTAGAATTGCTGG - Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
938374294 2:130795710-130795732 CTGACCAGGAGGTGAATGGCAGG + Intergenic
938971729 2:136439000-136439022 ATTACCACCAGGACAATTGCTGG - Intergenic
945383854 2:209173739-209173761 TTGACCACAAGTAAAATTGAAGG - Intergenic
1168837754 20:888978-889000 GTGACCAGGAGGAGAGTGGCAGG - Intronic
1182112560 22:27733841-27733863 TTGTCCAGGAGGTGAATGGCTGG - Intergenic
1183955484 22:41378108-41378130 TTGGCCATGAGGAGACTTGATGG - Intronic
1184540131 22:45116841-45116863 ATGTCCAGGAGTAGAATTGCTGG - Intergenic
956217716 3:66866756-66866778 TTGAGCACAAGGAGAAATCCTGG - Intergenic
958452582 3:94292692-94292714 TTGACCTTGAGGAGAATCACTGG + Intergenic
958584167 3:96064646-96064668 TTTACCTGGAGTAGAATTGCTGG - Intergenic
964108278 3:153062376-153062398 TTGACAACAAGGAGATATGCAGG + Intergenic
967370676 3:188742271-188742293 ATGTCAAGGAGGAGAATTGCTGG - Intronic
976362533 4:84196632-84196654 TTAACCATGAGGAGAGTTGGGGG - Intergenic
981910490 4:149975470-149975492 TTAACCTCGAGCAGAATTACTGG + Intergenic
984011194 4:174373927-174373949 TTGACCAAGCTGAGAATTGCAGG - Intergenic
987401358 5:17480407-17480429 TTGACCAAGAGGAGACAGGCCGG + Intergenic
996543083 5:124649682-124649704 TTGACCACTAGGACACCTGCAGG + Exonic
998285456 5:140856314-140856336 TTGACCGCGAGGAGCTGTGCGGG + Exonic
1000916261 5:167085925-167085947 TTGATCACTATGAGAATTTCAGG + Intergenic
1001850697 5:174962383-174962405 TTTACCAAGATGAGAAATGCAGG - Intergenic
1002541885 5:179911627-179911649 TTGACCACATGGAGTATTGTTGG - Intergenic
1004939727 6:20543179-20543201 TTGCCCAGGAGTACAATTGCTGG + Intronic
1008151559 6:47958242-47958264 TTGACCAGGAGTAGAAGTCCAGG - Intronic
1016322883 6:142866666-142866688 AGGACAACGAGGAGAATTACTGG + Intronic
1018488786 6:164270875-164270897 TTGTCCACGCAGAAAATTGCAGG + Intergenic
1021117452 7:16759981-16760003 CTGGCCAGGAGGAGTATTGCTGG + Intronic
1023357361 7:39380859-39380881 GTGAGCACGAGTAGAATTTCTGG - Intronic
1028552869 7:92090801-92090823 ATGACTAAGAGCAGAATTGCTGG + Intronic
1028649226 7:93131985-93132007 TACTCCAGGAGGAGAATTGCAGG - Exonic
1032498632 7:132382145-132382167 TTGTCCAAGAGGACAAATGCAGG - Intronic
1033383346 7:140846139-140846161 TATACCAGGAGTAGAATTGCAGG - Intronic
1041450432 8:58000661-58000683 TTGACCAAGAGTAGAAATGGTGG - Intronic
1049002713 8:139836411-139836433 TTGCCCCTGGGGAGAATTGCAGG - Intronic
1056001664 9:82223743-82223765 ATAACCAGGAGTAGAATTGCTGG - Intergenic
1057771899 9:97975583-97975605 TTGCCTAGGAGTAGAATTGCTGG + Intergenic
1058101529 9:100922651-100922673 TTGCCCAGTAGTAGAATTGCTGG + Intergenic
1059190860 9:112324975-112324997 ATGACTAGGAGCAGAATTGCTGG - Intronic
1060440162 9:123631228-123631250 TTGACTACAAGGAGTAGTGCTGG - Intronic
1060449698 9:123725575-123725597 TTAACCACGAGCAGAACTGCAGG + Intronic
1188385777 X:29555872-29555894 TTGGCCATGCTGAGAATTGCAGG + Intronic
1197902272 X:131387027-131387049 ATGCCTAGGAGGAGAATTGCTGG + Intronic