ID: 1132492418

View in Genome Browser
Species Human (GRCh38)
Location 16:239902-239924
Sequence CAGAACCACTTTAAAGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132492418_1132492425 25 Left 1132492418 16:239902-239924 CCATGATCTTTAAAGTGGTTCTG 0: 1
1: 0
2: 4
3: 10
4: 231
Right 1132492425 16:239950-239972 TGTCTTGAGATTATTCTTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 164
1132492418_1132492421 -8 Left 1132492418 16:239902-239924 CCATGATCTTTAAAGTGGTTCTG 0: 1
1: 0
2: 4
3: 10
4: 231
Right 1132492421 16:239917-239939 TGGTTCTGGAAAAATGGTTATGG 0: 1
1: 0
2: 1
3: 17
4: 221
1132492418_1132492424 22 Left 1132492418 16:239902-239924 CCATGATCTTTAAAGTGGTTCTG 0: 1
1: 0
2: 4
3: 10
4: 231
Right 1132492424 16:239947-239969 CTTTGTCTTGAGATTATTCTTGG 0: 1
1: 0
2: 1
3: 26
4: 286
1132492418_1132492422 -7 Left 1132492418 16:239902-239924 CCATGATCTTTAAAGTGGTTCTG 0: 1
1: 0
2: 4
3: 10
4: 231
Right 1132492422 16:239918-239940 GGTTCTGGAAAAATGGTTATGGG 0: 1
1: 0
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132492418 Original CRISPR CAGAACCACTTTAAAGATCA TGG (reversed) Intronic
903598545 1:24516162-24516184 AAGAAACACTTGAAAGAACAGGG + Intronic
905754045 1:40492556-40492578 CAGAACAACTTTAAAGAACAAGG - Intronic
905809731 1:40903252-40903274 CAGAATTATTTTAAAGATCCAGG - Intergenic
907642390 1:56204092-56204114 CAGAATGACTTTAAGGATGATGG + Intergenic
907722580 1:56985857-56985879 CAGAGGCATTTTAGAGATCATGG - Intergenic
908464033 1:64374117-64374139 CAGAACCACTTGAAACCACATGG + Intergenic
909347445 1:74608278-74608300 CAGAAACATTTTTCAGATCATGG - Intronic
909772933 1:79447438-79447460 AAGAACAACATTAAACATCATGG - Intergenic
911673102 1:100629524-100629546 CAGCACTACTTTAAATATCATGG - Intergenic
913956087 1:143295391-143295413 CAGGACCACTGGTAAGATCAAGG - Intergenic
913981344 1:143520049-143520071 CAGGACCACTGGTAAGATCAAGG + Intergenic
914075717 1:144346704-144346726 CAGGACCACTGGTAAGATCAAGG + Intergenic
914103461 1:144619792-144619814 CAGGACCACTGGTAAGATCAAGG - Intergenic
915376904 1:155404371-155404393 CAGAAGCAATTTAAAAATAAAGG + Intronic
916677694 1:167077473-167077495 CAGAATCAGTGTAAAGTTCATGG - Intronic
919014316 1:192011078-192011100 TAGAAACACTTTAAAAAGCAGGG + Intergenic
920457843 1:206114694-206114716 TAGAACCACTTTTAAAATCAGGG + Intronic
922843184 1:228661323-228661345 AAAAACTACTTTAAAGTTCATGG + Intergenic
923287997 1:232515273-232515295 CAGAGCCTCTTCAAAGTTCAAGG - Exonic
923709471 1:236374792-236374814 GAGACCCACTTTAAATATAAAGG - Intronic
1063197322 10:3755818-3755840 CAGAACCACTTTGAAGATCGGGG - Intergenic
1064525002 10:16246002-16246024 CAAATCCACTTTAAATATAAAGG + Intergenic
1067656258 10:48194220-48194242 TATACCCAATTTAAAGATCATGG + Intronic
1068792513 10:61042464-61042486 CACAAGCTCTTTAAATATCAAGG - Intergenic
1068847723 10:61698409-61698431 CAGAACCGCTTTCAAAAACAGGG - Intronic
1069222937 10:65906377-65906399 CATAACCACTTTATAGGTTAGGG + Intergenic
1069292617 10:66800421-66800443 CAGCAATACTTTAAAAATCAAGG + Intronic
1072210841 10:93245803-93245825 CAGAAATAATTTAAAGAACAAGG - Intergenic
1073117358 10:101099045-101099067 CAGCCCCACTTTATAGATGAGGG + Intronic
1073129357 10:101176974-101176996 TAGAACCACTGCAAATATCATGG - Intergenic
1075408298 10:122209293-122209315 CAGAGCCACTGTGAAGATCAGGG - Intronic
1075525911 10:123186660-123186682 CAGAAACACTTTCAAGTTCTAGG - Intergenic
1075559364 10:123457181-123457203 CAGAACCACACAAAAGCTCAGGG + Intergenic
1076494356 10:130887151-130887173 AAGAACCAATCCAAAGATCAAGG + Intergenic
1076998830 11:312067-312089 GAGAAACAGTTTATAGATCAAGG - Intronic
1077172514 11:1174286-1174308 CAGAACCACTGTGCAGAGCAGGG - Intronic
1080054697 11:27894051-27894073 CTGATGCACTTTGAAGATCAAGG + Intergenic
1080145181 11:28973789-28973811 CAGATCCACTTAAAATATAATGG - Intergenic
1080220732 11:29900523-29900545 CAGAAGCATTTTAAAGTTCCTGG - Intergenic
1085654914 11:78305162-78305184 CATAATCATTTTACAGATCAAGG + Intronic
1088776936 11:113094336-113094358 CAGAATCACTGTAGAGATGATGG + Intronic
1089316561 11:117595145-117595167 CAGAAGCACTTTAATGAGGAAGG + Intronic
1089340675 11:117755227-117755249 CAGAAACACTCAAAAGACCAGGG + Intronic
1089529183 11:119115535-119115557 CAGAACCAGTATAATGAGCAAGG - Intronic
1090938645 11:131368206-131368228 CAGAACGATGATAAAGATCATGG - Intergenic
1090988262 11:131792731-131792753 CAATACCAATTCAAAGATCAAGG - Intronic
1091397408 12:162514-162536 AAGTCCCACTTTAAAAATCATGG - Intronic
1091954632 12:4628238-4628260 CAAGTCCACTTTGAAGATCAAGG - Exonic
1093405155 12:18796166-18796188 CACAACCATTTTCAATATCATGG + Intergenic
1094074258 12:26455760-26455782 AAGAAGCCATTTAAAGATCAAGG + Intronic
1094392262 12:29964411-29964433 CATAACCCTTTTAAAGATCCAGG + Intergenic
1099364866 12:81756335-81756357 CAGAACAACTTTAAATTCCAAGG + Intronic
1099629131 12:85117557-85117579 CAGGTCCACTCTAGAGATCAAGG + Intronic
1100005998 12:89896341-89896363 CAAAATCACTTAAAAGAGCATGG + Intergenic
1100233037 12:92629427-92629449 CAGAACCATTTTATGGAGCATGG + Intergenic
1100503925 12:95201230-95201252 CTGAACCACCTGGAAGATCAGGG + Intronic
1103248022 12:119474934-119474956 CAGGACCTCTTTAAAGCCCAGGG + Intronic
1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG + Intergenic
1105658581 13:22468120-22468142 CAGAACAACTTCAAAGATCAGGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1109059930 13:57602647-57602669 CAGAAGCATTTTGAAGAGCAGGG - Intergenic
1111112460 13:83731988-83732010 CAGAATCATTTTAGAGATCTTGG - Intergenic
1113786983 13:113007094-113007116 TAGAACAACTTAAAAAATCAAGG - Intronic
1115178430 14:30592899-30592921 GAGTACAACTTTAAACATCAAGG + Intronic
1116597885 14:46875808-46875830 CAGAACAAATGTAAAGATAAAGG + Intronic
1117256979 14:53987761-53987783 CAAACCCACTTTAAATATAAAGG - Intergenic
1117411298 14:55453654-55453676 CAAGACCAATGTAAAGATCAAGG - Intronic
1117450236 14:55842973-55842995 AGGCACCACTTTAAATATCAGGG - Intergenic
1119612164 14:76072759-76072781 CAGAATCATTATAGAGATCAGGG + Intronic
1119984260 14:79118018-79118040 CAGAACCATTTCAAAGATACAGG + Intronic
1120111062 14:80557388-80557410 CACAACCATTTTACAGATGAAGG + Intronic
1123205339 14:106707251-106707273 CATCACCATTTTTAAGATCAAGG - Intergenic
1123210383 14:106754518-106754540 CATCACCATTTTTAAGATCAAGG - Intergenic
1202938593 14_KI270725v1_random:118919-118941 CAGGACCACTGGTAAGATCAAGG - Intergenic
1123394608 15:19918973-19918995 CAGGACCACTGGTAAGATCAAGG + Intergenic
1125103300 15:35940892-35940914 CAGCTCCACTTTAAACACCAAGG - Intergenic
1126953386 15:53907907-53907929 CAGAAACAAATTAAATATCAAGG - Intergenic
1127016530 15:54695038-54695060 CAGAACCACCATACAGACCAAGG + Intergenic
1130658766 15:85813310-85813332 CTGAACCACTTTAAATAACATGG - Intergenic
1132492418 16:239902-239924 CAGAACCACTTTAAAGATCATGG - Intronic
1136700644 16:32137072-32137094 CAGGACCACTGGTAAGATCAAGG + Intergenic
1136767014 16:32790393-32790415 CAGGACCACTGGTAAGATCAAGG - Intergenic
1136801135 16:33080308-33080330 CAGGACCACTGGTAAGATCAAGG + Intergenic
1136863275 16:33715783-33715805 CAGGACCACTGGTAAGATCAAGG - Intergenic
1136955287 16:34777320-34777342 CAGGACCACTGGTAAGATCAAGG + Intergenic
1137085102 16:36110722-36110744 CAGGACCACTGGTAAGATCAAGG - Intergenic
1137092193 16:36207400-36207422 CAGGACCACTGGTAAGATCAAGG + Intergenic
1137221642 16:46458207-46458229 CAGGACCACTGGTAAGATCAGGG - Intergenic
1203069409 16_KI270728v1_random:1052639-1052661 CAGGACCACTGGTAAGATCAAGG - Intergenic
1203124766 16_KI270728v1_random:1563934-1563956 CAGGACCACTGGTAAGATCAAGG - Intergenic
1143283949 17:5775126-5775148 CAGAACCACACTAGACATCAGGG - Intronic
1145324119 17:21785010-21785032 CAGGACCACTGGTAAGATCAAGG - Intergenic
1145689476 17:26722954-26722976 CAGGACCACTGGTAAGATCAAGG + Intergenic
1149522937 17:57331914-57331936 GAGTACGATTTTAAAGATCAAGG - Intronic
1203182745 17_KI270729v1_random:78918-78940 CAGGACCACTGGTAAGATCAAGG + Intergenic
1153039454 18:798090-798112 GAGAACCACCTTCATGATCATGG + Intronic
1154516527 18:15173396-15173418 CAGGACCACTGGTAAGATCAAGG - Intergenic
1155356700 18:24960450-24960472 CAGAACTTCCTTAGAGATCAGGG - Intergenic
1156192714 18:34738185-34738207 CAAAGCCACTTTAAAGATTCGGG + Intronic
1157212835 18:45758783-45758805 CAGAAACACTTTAAAGATCTTGG - Intergenic
1158694697 18:59693493-59693515 AAGAACCACTTTGAAGAACATGG + Intronic
1159889654 18:73941771-73941793 AAGAACCACTTGTAAGATTAAGG + Intergenic
1162295256 19:9809066-9809088 CTGAACCACTTGAAAGATGCAGG - Intergenic
1162650885 19:12088148-12088170 CAGAAAGAGTTTAATGATCATGG + Intergenic
1163206328 19:15805943-15805965 CAGACTCTCTTTAAACATCAAGG - Intergenic
1164417910 19:28061526-28061548 GAGAACCACTGTAAACATCTGGG + Intergenic
1165197160 19:34113247-34113269 AAGAAACACTTTAAATATAAGGG - Intergenic
1166534699 19:43565291-43565313 CAAAACCACTTTAAATAGAAGGG + Intronic
925472928 2:4182496-4182518 CATCACTGCTTTAAAGATCAAGG - Intergenic
925634997 2:5934350-5934372 GAGAAACACCTAAAAGATCAGGG - Intergenic
927828730 2:26329436-26329458 CTGATGCACTTTAAAGATAAAGG + Intronic
929125285 2:38517965-38517987 CAGAAAAAGTTTAAAGCTCAAGG - Intergenic
929754523 2:44753064-44753086 CAGAAATTCTCTAAAGATCAGGG + Intronic
929913286 2:46112279-46112301 GAAAACCACTTTAAATATAAAGG - Intronic
929939672 2:46323911-46323933 CAGAAACACGCAAAAGATCATGG - Intronic
930284511 2:49411121-49411143 CAGGAGCAACTTAAAGATCATGG - Intergenic
932050432 2:68392817-68392839 CATAAACTCTTTAAAGATCAGGG + Intronic
934252375 2:90369052-90369074 CAGGACCACTGGTAAGATCAAGG - Intergenic
935293350 2:101627946-101627968 CAGAACCCCTCCAAAGATCAAGG + Intergenic
938516849 2:132018390-132018412 CAGGACCACTGGTAAGATCAAGG - Intergenic
939466996 2:142569959-142569981 CAGACTCACTTTAAATAACAAGG - Intergenic
940541010 2:155017975-155017997 GAAAACCACTTTAAATATAAAGG - Intergenic
942064756 2:172260236-172260258 CACAACCACAGTAAAGATCTAGG - Intergenic
943559094 2:189440164-189440186 CAGCACCACTGTAAAAATCAGGG - Intergenic
944068277 2:195642427-195642449 CAGAACCATTTTAAGGATTGGGG + Intronic
945527503 2:210906417-210906439 CATAATCACTTTAAATATAATGG + Intergenic
947872372 2:233446602-233446624 CAGAAACGGTGTAAAGATCAAGG + Intronic
948059982 2:235035692-235035714 TAGAACCACCTTCTAGATCAGGG - Intronic
1169779642 20:9295085-9295107 AAGAACCCCTTGAAAGATCCAGG + Intronic
1170203256 20:13768046-13768068 CAGAACCAACATAATGATCAGGG - Intronic
1172830400 20:37829268-37829290 CAGGGCCACTTTAAAATTCAAGG - Intronic
1175375749 20:58522771-58522793 CAGAACCACTTGCAAGCTGATGG - Intergenic
1176584722 21:8570214-8570236 CAGGACCACTGGTAAGATCAAGG + Intergenic
1177942953 21:27433440-27433462 AAAAACTACTTTAAAGTTCATGG - Intergenic
1180267533 22:10547116-10547138 CAGGACCACTGGTAAGATCAAGG + Intergenic
1180659695 22:17455493-17455515 CTGACCCACTTTATAGTTCATGG + Intronic
1180723928 22:17930664-17930686 CAGCACCACTGTCCAGATCAGGG - Intronic
1182392763 22:30013139-30013161 CAGTACCATTTTAGTGATCATGG + Intronic
1183559713 22:38562395-38562417 CAAAAAGAGTTTAAAGATCATGG + Intronic
1184990142 22:48161964-48161986 CCGAACCACCTTAAAAATGAAGG - Intergenic
1203325727 22_KI270738v1_random:14529-14551 CAGGACCACTGGTAAGATCAAGG - Intergenic
950050961 3:9989110-9989132 CAGCACCACTGTCAAGATAATGG + Intronic
950058048 3:10044227-10044249 CAGCACCACTGTCAAGATAATGG + Intronic
950299227 3:11860873-11860895 CAGCACCACTGTCAAGATAATGG + Intergenic
952905344 3:38136463-38136485 CAGGACCCCTTCAAAGGTCAAGG + Intronic
953702182 3:45205356-45205378 CAGAGTCACTTTAATGATGAAGG + Intergenic
954571726 3:51646638-51646660 CAGAACCATTTAAAACACCAGGG - Intronic
955755250 3:62219153-62219175 CAGATCCACTTTTGAGGTCAAGG + Intronic
956788941 3:72665832-72665854 CAGAACCTCATTCAAAATCAGGG - Intergenic
956863630 3:73348623-73348645 CATAAGCACTTCACAGATCAAGG + Intergenic
957123884 3:76132967-76132989 CAGCCCCACTTTATAGATGAGGG - Intronic
957789906 3:84927391-84927413 AAGAACCAATATAAAAATCAAGG + Intergenic
958660875 3:97065214-97065236 CTAAATCCCTTTAAAGATCAGGG - Intronic
959251401 3:103952327-103952349 AAGCACCACTTTAAGTATCATGG - Intergenic
960165272 3:114394443-114394465 CAGAGCCACTGGAAAGATCTGGG + Intronic
961532128 3:127546360-127546382 CAGAATCACTGTGAAGTTCATGG + Intergenic
963929662 3:150990410-150990432 CAGAAACAGTTAAAATATCAAGG + Intergenic
968423241 4:502913-502935 CCGAACCTCTTTATACATCATGG - Intronic
971370868 4:26017772-26017794 AAGAACTAGTTTCAAGATCAAGG - Intergenic
975151232 4:71023338-71023360 CAGAACCCCTTAGAAGATCTTGG + Intronic
977427982 4:96893050-96893072 CAGAATCACTTAAAAATTCAAGG - Intergenic
978153708 4:105466425-105466447 CATAAGCACTATAAAGATAAAGG + Intronic
978989301 4:115058720-115058742 CAGAACCAGTTTCAATTTCAAGG + Intronic
979322435 4:119340222-119340244 CAGAGCCACTTTACACATTAAGG - Intergenic
980624816 4:135361069-135361091 AAACACCACTTTAAAAATCAGGG + Intergenic
981934601 4:150225730-150225752 AAGAACCACATTAAAAAGCAAGG - Intronic
982322356 4:154091915-154091937 ATGAACCAATTTAAAGATCTAGG + Intergenic
983761338 4:171410120-171410142 CATAGCCATTTTAAAGAACAAGG + Intergenic
984746217 4:183221062-183221084 CAGACCTACTTTAAATATAAAGG + Intronic
985931543 5:3061856-3061878 CAGGAGCACTTTACAGAGCAGGG - Intergenic
987995323 5:25269622-25269644 CAAAACCATTCAAAAGATCAAGG - Intergenic
989484940 5:41978487-41978509 TAGAACCACTTTAAACATTTTGG + Intergenic
989504718 5:42214756-42214778 AAGTACCACTTTAATGATCTTGG + Intergenic
992241081 5:74770434-74770456 CAGAACAAGTTTATATATCATGG - Intronic
993428599 5:87801293-87801315 CAGAACCTATTTAAACATCTTGG - Intergenic
993681921 5:90889233-90889255 GACAAACACTTAAAAGATCAAGG - Intronic
996892704 5:128441190-128441212 TAGATCCAGTTTAAAGATCCTGG - Intronic
997458869 5:134038727-134038749 CAGAACTACTTTAATTGTCACGG - Intergenic
999716020 5:154360688-154360710 CCAAACCAGATTAAAGATCATGG + Intronic
999955743 5:156699774-156699796 CAGAGCTACTCTAAAGAACAGGG - Intronic
1000456526 5:161456151-161456173 AAGAAAAACTTTAAATATCAAGG - Intronic
1003086923 6:3068168-3068190 CAGCCCCACTTTACAGATGAAGG + Intronic
1007803240 6:44416148-44416170 CAGAACCACTAGGAAAATCATGG + Intronic
1007909424 6:45498715-45498737 CAGAACTCCTTTAAAAATTAAGG + Intronic
1008832705 6:55787055-55787077 CAGAAGAAATTCAAAGATCAAGG - Intronic
1012196490 6:96348106-96348128 CAGAACCACTTTGAAGCCGATGG + Intergenic
1012231331 6:96763846-96763868 CATCACCACTTTAAAGACCCTGG - Intergenic
1012359249 6:98356550-98356572 CACAATTACTTTAAACATCAGGG - Intergenic
1014432251 6:121384665-121384687 CAGAACCTCTATAAATATTAAGG - Intergenic
1014970748 6:127812235-127812257 CATAACCACTCTAAAGATTTTGG - Intronic
1016352431 6:143182633-143182655 CAAAACCACATTATATATCAAGG - Intronic
1016898176 6:149074514-149074536 CAAAACCACTTCAGAGACCAGGG + Exonic
1017277424 6:152585752-152585774 TAGAACTATTTTAAAAATCATGG - Intronic
1018489449 6:164276496-164276518 CTGAAAAACTTTAAAGTTCAAGG - Intergenic
1024585598 7:50839165-50839187 CAGAATTACTTAAAAGGTCAGGG + Intergenic
1025319428 7:58078366-58078388 CAGGACCACTGGTAAGATCAAGG + Intergenic
1025477845 7:60948836-60948858 CAGGACCACTGGTAAGATCAAGG + Intergenic
1025483266 7:61013101-61013123 CAGGACCACTGGTAAGATCAAGG + Intergenic
1025554285 7:62285109-62285131 CAGGACCACTGGTAAGATCAAGG - Intergenic
1025560496 7:62368165-62368187 CAGGACCACTGGTAAGATCAAGG + Intergenic
1027946588 7:84753763-84753785 CAGTAACACTGTAATGATCATGG - Intergenic
1028712548 7:93926175-93926197 AAGAACCCCTTTAAAGAAAAAGG + Exonic
1031289807 7:119919398-119919420 CAGTAACATTTTTAAGATCATGG - Intergenic
1032304446 7:130719483-130719505 CATATCCAGTTTAAAGACCATGG + Intergenic
1034042443 7:147893790-147893812 CAGAATCACTTCCAAGATCTGGG - Intronic
1034561488 7:151882450-151882472 CACATCCACTTTACAGATGAAGG + Intergenic
1035272481 7:157728497-157728519 CAAAACAGCTTTAAAGTTCAAGG + Intronic
1035479466 7:159170455-159170477 CAGAAACACGTGGAAGATCATGG + Intergenic
1035838616 8:2786523-2786545 AGGAACCACATTAAAGACCAAGG + Intergenic
1036067123 8:5393787-5393809 AAAAACCACTTTAAATATGAAGG + Intergenic
1036084799 8:5601727-5601749 CAGCATCACTTTACAGATGATGG + Intergenic
1036955401 8:13182818-13182840 AAAAACTACTTTAAAGTTCATGG - Intronic
1037571512 8:20161927-20161949 CACAGCCACTTCCAAGATCACGG - Intronic
1039867110 8:41514875-41514897 CAGAACCAAAATAAAGATCTTGG + Intergenic
1041046168 8:53888434-53888456 CAGAACCACCATTTAGATCAGGG + Intronic
1043238626 8:77901781-77901803 CATAAATAATTTAAAGATCAAGG + Intergenic
1043657121 8:82682002-82682024 GAAAACCACTTTAAATATAATGG - Intergenic
1048805504 8:138237466-138237488 CAGACCGTCATTAAAGATCAAGG - Intronic
1050019619 9:1269559-1269581 CAGACCCACTTTAAAGGCCCAGG - Intergenic
1050125710 9:2354428-2354450 CAGAACCTCTTTGCAGTTCAGGG + Intergenic
1050871119 9:10571573-10571595 CATGACCACTTTACAGATGAGGG - Intronic
1052352064 9:27468255-27468277 CAGAAGCACTTCATAGATGATGG - Intronic
1055693908 9:78862294-78862316 TAGAACCACCATACAGATCAAGG + Intergenic
1056433273 9:86549732-86549754 CAGAACCACATAAAATTTCATGG - Intergenic
1056474288 9:86938370-86938392 CACAACCACTGTAAAAATGAGGG - Intergenic
1057486850 9:95492107-95492129 CAGAAGCAGTTGAAGGATCAGGG - Intronic
1058394148 9:104530408-104530430 GAGAACCAATTTAAAGAGCTGGG - Intergenic
1058872751 9:109216729-109216751 CAGAAGCACTTTAGGGATTATGG - Intronic
1060452894 9:123760187-123760209 CAGAAGAAATTTAAAAATCATGG + Intronic
1060558471 9:124522738-124522760 CAGCACCACCTTAAAGAGGAGGG + Exonic
1061286055 9:129623382-129623404 CAGACCCACTTTCAAGTCCATGG + Intronic
1061928969 9:133822501-133822523 AAGAACCGCTTTACACATCAGGG + Intronic
1203614627 Un_KI270749v1:47736-47758 CAGGACCACTGGTAAGATCAAGG + Intergenic
1185958673 X:4521312-4521334 CAGAATCATTTTATATATCATGG + Intergenic
1186118804 X:6335260-6335282 CAGAACAACATCTAAGATCAGGG - Intergenic
1186949171 X:14603708-14603730 AAAAACCCATTTAAAGATCATGG - Intronic
1187202058 X:17144650-17144672 CAGAACCTCTTGAATGATGAAGG + Intronic
1187944632 X:24414362-24414384 CAAACCCACTTTCAAGATAATGG - Intergenic
1189592381 X:42528870-42528892 CAGAATAACTTTAAAGTTGAAGG - Intergenic
1191996774 X:67104229-67104251 CAGAAACTCTTTAAAAATTAGGG - Intergenic
1192962028 X:76141366-76141388 CAGAACGAGTTTAATGATGATGG + Intergenic
1194161219 X:90454680-90454702 CAGAAACACCTTAAAGATCTGGG + Intergenic
1196291739 X:113949940-113949962 GAGAACCACCTTCATGATCATGG - Intergenic
1196322797 X:114362551-114362573 TATAACTACTTTAAAGATAAAGG + Intergenic
1199058128 X:143321379-143321401 CTGAACCACTTGAAAGTGCAGGG + Intergenic
1200507509 Y:4031614-4031636 CAGAAACACCTTAAAGATCTGGG + Intergenic