ID: 1132497409

View in Genome Browser
Species Human (GRCh38)
Location 16:270451-270473
Sequence CCTCCATGTCCCCACCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132497409_1132497417 14 Left 1132497409 16:270451-270473 CCTTGAGGGTGGGGACATGGAGG 0: 1
1: 0
2: 0
3: 48
4: 415
Right 1132497417 16:270488-270510 CCCCTCCTGCCCCTGCAGGCTGG 0: 1
1: 3
2: 8
3: 116
4: 689
1132497409_1132497415 10 Left 1132497409 16:270451-270473 CCTTGAGGGTGGGGACATGGAGG 0: 1
1: 0
2: 0
3: 48
4: 415
Right 1132497415 16:270484-270506 ATGACCCCTCCTGCCCCTGCAGG 0: 1
1: 0
2: 4
3: 33
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132497409 Original CRISPR CCTCCATGTCCCCACCCTCA AGG (reversed) Intronic
900317700 1:2067622-2067644 CCCCCGTGCCACCACCCTCATGG - Intronic
900318418 1:2070672-2070694 CCCCCATGGCTCCACCCACATGG - Intronic
900428308 1:2590442-2590464 CCCCCAAGTGCCCACCCCCAGGG - Exonic
900982328 1:6053343-6053365 CAACCAGGTCCCCAACCTCACGG + Intronic
901004247 1:6164159-6164181 CCTCCATCTCCCTTCCCTCTAGG + Intronic
901051889 1:6429502-6429524 GGGACATGTCCCCACCCTCACGG + Intronic
901829377 1:11882881-11882903 CCTCCCTGCTCCCAGCCTCAAGG - Intergenic
902292828 1:15446484-15446506 CCCCCATGGACCCACCCTCCGGG + Intronic
902374995 1:16026430-16026452 CCTCCATCTCCCCAACCCCCAGG - Intronic
902393013 1:16117019-16117041 CAGGCCTGTCCCCACCCTCATGG + Intergenic
902411733 1:16215867-16215889 CCACCTGGTCCCCACCCACACGG - Intergenic
902482346 1:16718512-16718534 GGGACATGTCCCCACCCTCATGG - Intergenic
902919658 1:19658212-19658234 CCCCCAGGTCCCCACCTTCTAGG - Intronic
902980559 1:20119599-20119621 CCTCCCAGCCCCCACTCTCATGG + Intergenic
903065753 1:20698349-20698371 TCTCCATGTTCCCACCCGCTTGG + Intronic
903181793 1:21608575-21608597 GCTTCATGTCCCCACCCCCCAGG + Intronic
903213533 1:21831262-21831284 CTTCCATGACCTCAACCTCACGG - Exonic
903465812 1:23552175-23552197 CTTCCATTTCACCCCCCTCAGGG - Intergenic
904304411 1:29578281-29578303 CCACCATGTCCCCACCGCAAGGG - Intergenic
904367457 1:30023710-30023732 GCTCCATGTGCCACCCCTCAGGG - Intergenic
905279042 1:36837229-36837251 CCTCCAAGTGCCCAGCCACAGGG + Intronic
905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG + Intergenic
905619894 1:39435638-39435660 CCACCATTTCCCCTTCCTCAGGG - Exonic
905799466 1:40834112-40834134 CCTCCATGTGCCCAGTGTCAAGG + Intronic
906238998 1:44229924-44229946 CATCCATGTCCCCACAGCCATGG + Intronic
906336445 1:44935911-44935933 CCACAATATCCCTACCCTCAAGG - Intronic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
907339952 1:53727713-53727735 CCTCCCTCTCCCCTCCCTCTGGG - Intronic
908350894 1:63285940-63285962 CCCCCATGGCCCCAGCCTCCAGG + Intergenic
910366937 1:86475896-86475918 CCTCCATGTCTCCATCCTTCAGG - Intronic
911656896 1:100454322-100454344 CCTCCTTGTCTCCATCCTCAGGG - Intronic
912490654 1:110060929-110060951 TCTCCATATTCCCACCCCCATGG - Exonic
912953092 1:114134096-114134118 CCTCCAAGTCCCCTTTCTCACGG + Intronic
913200781 1:116493983-116494005 CCTCCAGCTCCCCCACCTCAGGG + Intergenic
913219125 1:116645330-116645352 CCTCCAGGACCCCAGCCTCAGGG - Intronic
913547598 1:119884893-119884915 CTTTCATGTCACCACCCTCCTGG - Intergenic
913556590 1:119973370-119973392 CCTTCACGTCACCACCCTCCTGG + Intronic
913942089 1:125118854-125118876 CCTTCATGTCCCCGCCGTCGTGG + Intergenic
914691990 1:150037950-150037972 CCTCCACCTCCCCAGGCTCAGGG + Intergenic
915168924 1:153964140-153964162 CCACCACGTCCCCACCCACCTGG - Intronic
915288522 1:154867952-154867974 CCTCCATCTCCACTCCCTCTGGG + Intronic
915540572 1:156563396-156563418 CATCCTTTTTCCCACCCTCAAGG + Intronic
915671435 1:157491963-157491985 CCTGCATCTCCCCACCCTACAGG - Intergenic
915731159 1:158055488-158055510 CCTCAGTTTCCCCAACCTCATGG + Intronic
915905940 1:159877249-159877271 CCTCCGCATCTCCACCCTCAAGG + Intronic
916194848 1:162213096-162213118 CGCCCACCTCCCCACCCTCAAGG + Intronic
917727950 1:177845600-177845622 CCTCAATGTCCTCAACATCATGG - Intergenic
917860319 1:179137739-179137761 CATCACTGTCCTCACCCTCAGGG - Intronic
918339055 1:183552224-183552246 CGTGCATGTCCCCAGCCACATGG + Intronic
919744530 1:201000265-201000287 CCTCCACGCCCCCAGCCCCAGGG - Intronic
920044714 1:203125918-203125940 CCTGCCTGTTCCCAGCCTCAGGG - Intronic
920836087 1:209512568-209512590 TCTCCATGTCCCCAGGCCCAGGG + Intergenic
921390628 1:214609733-214609755 CCTCCAACTCTCCACCCTCAAGG + Intronic
922585946 1:226735709-226735731 CCTCCAAGGCCCCATCCTCCTGG + Exonic
922853010 1:228750150-228750172 CCTCCATGTCACCAGCCACATGG + Intergenic
924169409 1:241322006-241322028 CCTCCATGTCTGCCCTCTCACGG + Intronic
924586936 1:245368365-245368387 CCTCCATATCCCCTGCATCAGGG + Intronic
1062854325 10:772228-772250 CCTCCATTTCCCCACCTCCCAGG - Intergenic
1062868311 10:876521-876543 ACTCCATGTCCCAACCCTCTGGG + Intronic
1062936787 10:1396286-1396308 CATCCCTGTCCCCACCCCCTCGG + Intronic
1067804720 10:49384770-49384792 CCTCGGTCTCCCCACCCTCCTGG + Intronic
1068958264 10:62840923-62840945 TCTTCATGTCCTCACCCTAATGG - Intronic
1069964378 10:72101981-72102003 CCTCCCTCCCTCCACCCTCAAGG - Intronic
1070325285 10:75384830-75384852 CCTCCCTGTCCCCAGCCCCCTGG + Intergenic
1070653906 10:78257806-78257828 CCTCCACGTTCCCACACCCAGGG + Intergenic
1070794466 10:79208611-79208633 CCCCCACGTGCACACCCTCAGGG + Intronic
1070961132 10:80500899-80500921 AGTTCATATCCCCACCCTCAGGG - Intronic
1071452443 10:85810259-85810281 CCACCATCTCTCCACCCACATGG + Intronic
1071463586 10:85920610-85920632 CCTCCATGTGCTCCCCTTCAAGG + Intronic
1071988364 10:91075261-91075283 CTGCCATGTCCCCATCTTCATGG - Intergenic
1072234943 10:93445684-93445706 GCTCCATGCCCACACCCGCATGG - Intronic
1072240839 10:93494648-93494670 CCTCAAGGTCCCCACTCACAGGG + Intergenic
1072501504 10:96022858-96022880 CCTACAACTCCCCTCCCTCAGGG - Intronic
1074544699 10:114393571-114393593 CCTCCCTGTCCCCAGCCTCCAGG - Intronic
1076109251 10:127848675-127848697 CTTCCCTGGCACCACCCTCACGG + Intergenic
1076235743 10:128862673-128862695 CCTCCAGCTCCCAACCCACACGG - Intergenic
1076990500 11:271061-271083 CTTCCATGTCACCACCCTGATGG + Intergenic
1077263541 11:1636675-1636697 CCTCCAGGTCACCACCAACAAGG + Intergenic
1077407820 11:2390589-2390611 CCTCCATGTCCCCATCCAAAAGG - Intronic
1078434041 11:11309883-11309905 TCACCCTGTCCCCACCCCCAGGG + Intronic
1078536655 11:12180240-12180262 CCTCATTCTCCCCTCCCTCAAGG - Intronic
1078741995 11:14075425-14075447 CCTCCCCCTCCCCACCCACAGGG - Intronic
1081353583 11:42085947-42085969 CCACAATGTCCCAACCTTCAAGG - Intergenic
1081805148 11:45886196-45886218 CCTCCTTCTCCCCAACCTCCGGG + Intronic
1081934147 11:46893305-46893327 CCTCAATTTCCTCATCCTCATGG - Intronic
1082727607 11:56755287-56755309 CCTACATTCCTCCACCCTCATGG - Intergenic
1083326339 11:61874826-61874848 CTCCCCTGTCCCCACCCTGAGGG + Intronic
1083726358 11:64630566-64630588 CCTCCATGTCCCCAGGACCAGGG - Exonic
1085391676 11:76185358-76185380 CTTCCGTGTCACCTCCCTCATGG - Intergenic
1086003203 11:82004082-82004104 CCGCCATGCCCCACCCCTCACGG + Intergenic
1088796928 11:113272820-113272842 ACTGCATGCCCCCACCCCCATGG + Intronic
1088918060 11:114242050-114242072 CCTCCAAATCCCCATGCTCAGGG - Intronic
1089700539 11:120241415-120241437 ACTCCAGGTCCCCTCCCTCCGGG - Intronic
1090274219 11:125408450-125408472 CCTCCATCGCCCCACCCACCCGG + Intronic
1090560620 11:127928159-127928181 CGTCCATGCCCCTACCCCCACGG - Intergenic
1090764952 11:129868529-129868551 TCTCCATGTGCGCACCCCCAAGG + Intronic
1091356441 11:134941306-134941328 TGTCCATGGCCCCACCCTCCAGG - Intergenic
1091375359 12:21634-21656 GCACCATTCCCCCACCCTCAGGG - Intergenic
1091390910 12:125648-125670 CCTCCATGCCCCCACCGGCCTGG - Exonic
1091660455 12:2379447-2379469 CTTCCTTGTCCCCAGCCCCAGGG - Intronic
1092106581 12:5925784-5925806 AAGCCATGCCCCCACCCTCACGG - Intronic
1092430544 12:8404851-8404873 TCTCCAAGTCCCCACCATAATGG - Intergenic
1092935240 12:13356166-13356188 CCTCCATGCCCCCACCATTCGGG - Intergenic
1095890931 12:47234875-47234897 ACTCCAGGTCCACTCCCTCAGGG + Intronic
1096180650 12:49548814-49548836 TCTGCGTGTCCCCACCCCCAGGG + Intronic
1097187057 12:57201707-57201729 CCTCACTCTCCCCACCCTCCCGG + Intronic
1098163458 12:67669785-67669807 TCTCCATCTCCCCACATTCACGG - Intergenic
1100826056 12:98475565-98475587 CCCCCATCTCCCCTCCCTCAGGG + Intergenic
1103764818 12:123272125-123272147 CATCCCTGCCCCCACCATCAAGG - Exonic
1103917334 12:124382691-124382713 CATCCATGTCTCTGCCCTCAGGG + Intronic
1104650108 12:130525240-130525262 CCTGCCGGTCCCCACTCTCAAGG - Intronic
1106339791 13:28817800-28817822 CATGCATGTCCCCACACTCCAGG - Intergenic
1109278978 13:60333955-60333977 CCTCCATATCCCCAACCAGATGG + Intergenic
1110287359 13:73765376-73765398 CCTCTTTGTGCCCACCCTCATGG - Intronic
1110544290 13:76738856-76738878 TCTCCATGTCCCTATCCACATGG - Intergenic
1110891628 13:80704623-80704645 GCTCTCAGTCCCCACCCTCACGG - Intergenic
1112909395 13:104463019-104463041 ACTCCATGTCCCCACATCCAGGG + Intergenic
1113747859 13:112757625-112757647 CCTCCTTGTCTCATCCCTCAAGG + Intronic
1113811321 13:113144241-113144263 CCTGCCTGTCCCCTCCCTCCGGG + Intronic
1114297760 14:21345483-21345505 CCTCCACCTCCCCAGGCTCAAGG + Intronic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1116855732 14:49950807-49950829 CTCCCATGTCCCCTCCCTCATGG - Intergenic
1117572436 14:57061279-57061301 CCTCCATGTGCATAGCCTCAGGG + Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1117956943 14:61130340-61130362 CCTCATTGTCCCAACCATCAAGG - Intergenic
1118767113 14:68917240-68917262 CCTTCATGTGCACACCTTCAGGG + Intronic
1118935027 14:70279861-70279883 CCTCCCTCCCCCCACTCTCAAGG - Intergenic
1118969585 14:70622112-70622134 ACTCCAAGGCTCCACCCTCAGGG + Intergenic
1120788536 14:88558489-88558511 CCTCACTGTCCCCTTCCTCAGGG - Intergenic
1121554280 14:94824545-94824567 CCTCCAGGGCTCCTCCCTCAGGG - Intergenic
1121782085 14:96628437-96628459 CCACCCTGTCCCCGCCCTCACGG - Intergenic
1121820029 14:96958740-96958762 CCTCAAAGTCCCCTCCCACAGGG + Intergenic
1122233630 14:100319999-100320021 CCTCCAGGTGCACACCTTCAGGG + Intergenic
1122296074 14:100706379-100706401 TCTCCATGCCACCACCCTCGAGG - Intergenic
1122788846 14:104176058-104176080 CCTCCAGGGGCCCCCCCTCAGGG - Exonic
1123681203 15:22765553-22765575 ACACAATGTCCCCACCCACAGGG + Intergenic
1123795220 15:23764054-23764076 CCTCCATGTCCCCAAACCCCTGG + Intergenic
1123977203 15:25564748-25564770 CCTCCAGCTCTCCACCGTCAGGG + Intergenic
1124532656 15:30520761-30520783 ACACAATGTCCCCACCCACAGGG - Intergenic
1124587812 15:31025655-31025677 CCTCCCAGTTCCCACTCTCAGGG + Intronic
1124596923 15:31098867-31098889 GCACCTTGTCCCCTCCCTCACGG - Intronic
1124765997 15:32486883-32486905 ACACAATGTCCCCACCCACAGGG + Intergenic
1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG + Intergenic
1125716379 15:41822123-41822145 CCCCCATGGCCCCTCCCTCCAGG - Intronic
1126325529 15:47473127-47473149 CATCTATGTCCCCAGTCTCACGG - Intronic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1127931174 15:63598497-63598519 CCTCCATGGTCCCAGCCTCATGG + Intronic
1128223044 15:65982186-65982208 CCTCCAGGTCCCGCCCCTCCAGG + Intronic
1128223051 15:65982201-65982223 CCTCCAGGTCCCGCCCCTCCAGG + Intronic
1128647187 15:69386615-69386637 CCTCCATGTCCCCCCTCCCCTGG + Intronic
1128812026 15:70579870-70579892 CCTCATTGTCCTGACCCTCAAGG + Intergenic
1129253397 15:74320667-74320689 CCTCCAGGCTCCCACCCCCAGGG + Intronic
1129650866 15:77487679-77487701 CTTCAATTTCCCCACCCTTAGGG - Intergenic
1130375823 15:83327665-83327687 CCTCCAAGGGCCCACCCTTATGG - Intergenic
1130594191 15:85237554-85237576 GCTCCATGTCCCCAAGCTCTGGG + Intergenic
1131095773 15:89653544-89653566 TCTCCCTGTCCCCTCCCGCAGGG + Intronic
1131209202 15:90479028-90479050 CCTCCATCTCCCACCCCTCTGGG - Intronic
1131283437 15:91039122-91039144 GCTCCATGTCCCCAAACTCTTGG - Intergenic
1131783033 15:95880776-95880798 CTTCCTTGTCCCCATCCTCCCGG - Intergenic
1131797440 15:96034141-96034163 CCTGCATGTCCCCAGACACAAGG - Intergenic
1132288646 15:100684145-100684167 CCTCCCAGCCTCCACCCTCAAGG + Intergenic
1132497409 16:270451-270473 CCTCCATGTCCCCACCCTCAAGG - Intronic
1132540531 16:506617-506639 CCCCCAAGCCCTCACCCTCACGG + Intronic
1132668756 16:1094272-1094294 CACCCATGTCCCCACCCTCTCGG - Intronic
1132754462 16:1475793-1475815 CCACCCTGTCCCCACCTTCTGGG + Intergenic
1132974075 16:2702862-2702884 CCCCCATGTCCCTGCACTCAGGG - Intronic
1133054437 16:3138482-3138504 CCTCCGTGCCCCCACCGTCGGGG - Exonic
1133805493 16:9123514-9123536 CCTCCCGGGCCCCTCCCTCAAGG + Intergenic
1134820664 16:17244253-17244275 CCCCCAAGGCCCCACCCCCAGGG - Intronic
1134868171 16:17627649-17627671 CCTCCTTGTTGCCACACTCATGG - Intergenic
1135218602 16:20593779-20593801 CCCCCAGGTCCCCACCCCCCAGG - Intergenic
1135830401 16:25767938-25767960 CGTTCATGTACCCACCCTTAGGG - Intronic
1136696455 16:32085242-32085264 CCTTCATGTCCCCGCCGTCGTGG - Intergenic
1136796953 16:33028516-33028538 CCTTCATGTCCCCGCCGTCGTGG - Intergenic
1138505201 16:57475060-57475082 CCTCCCCCTCCCCACCCCCAGGG + Intronic
1139930733 16:70524031-70524053 CCTCCTGGTCCCCAGCCTCTCGG - Intronic
1140255932 16:73336382-73336404 CCTCCCACCCCCCACCCTCAGGG + Intergenic
1141203211 16:81913256-81913278 CCTCCATCTCCCCAGCCCCAGGG + Intronic
1141983698 16:87565907-87565929 CCTCCCTGTCCCTCCCCTCAGGG + Intergenic
1141985180 16:87575264-87575286 CCTCCAACTCCCCAGCCTAAGGG + Intergenic
1142051378 16:87960174-87960196 CCTCCCTGTGGCCATCCTCACGG - Intronic
1142174504 16:88639028-88639050 CCACCATGACCCCTCCCTCAGGG + Exonic
1142238958 16:88936376-88936398 CCACCATGACCCCAGCCTCAGGG + Intronic
1142238968 16:88936411-88936433 CCACCACGACCCCAGCCTCAGGG + Intronic
1142238978 16:88936446-88936468 CCACCACGACCCCAGCCTCAGGG + Intronic
1142238988 16:88936481-88936503 CCACCACGACCCCAGCCTCAGGG + Intronic
1142742574 17:1939825-1939847 CCTCCAGGCCCCCACCCTGGAGG + Intronic
1144749545 17:17638909-17638931 CCTCCACCTCCCCAGGCTCAGGG - Intergenic
1145057959 17:19715414-19715436 CCTCCACGTCCCTACCCAGAAGG + Intronic
1145065236 17:19757471-19757493 CTTCCTTGTCCCCTTCCTCAGGG - Intergenic
1145247967 17:21282312-21282334 CTTCCTTGTCCCCACCCAGATGG + Intergenic
1145878820 17:28339535-28339557 CCTGCCTGTGCCCAGCCTCAGGG + Exonic
1146371433 17:32267111-32267133 CTTCCATCTCCCCACCCTGAGGG - Intronic
1147265408 17:39231607-39231629 GCCCCGTGTCCCCAGCCTCAAGG - Intergenic
1147326942 17:39674108-39674130 CCTCCATGCCCCCATCCCCGCGG - Intronic
1148028584 17:44604989-44605011 CCCCAATGTCCCCAAGCTCAGGG + Intergenic
1148517177 17:48230671-48230693 CCTCTATCTCCCCAGGCTCAGGG - Intronic
1149037230 17:52148599-52148621 TCTTCATCTCCCCTCCCTCATGG + Intronic
1149681302 17:58509144-58509166 ACTCCTTGTCCCTACCCTAATGG + Intronic
1150747957 17:67831644-67831666 CCCCCATGTCTCCACCATTAAGG - Intronic
1151929011 17:77219120-77219142 CCTCCGTGTCCCCAGGCTCCAGG - Intergenic
1152284480 17:79404271-79404293 CCTCCATGTCCCAGCCCACCAGG + Intronic
1152567362 17:81106305-81106327 CCACCATGCCTCCACCCTGAAGG - Intronic
1152657530 17:81526999-81527021 CCCCACTGTCCCCACGCTCAGGG - Intergenic
1152658426 17:81530645-81530667 CCACCAAGCCCCCACCCTGACGG + Intronic
1154087770 18:11323667-11323689 CTTCCACGCCCCCACCCCCAGGG + Intergenic
1154341345 18:13504991-13505013 CATCCCCGTCCCCATCCTCATGG - Intronic
1156243791 18:35278176-35278198 CCTCACTGTCCCCAACCTCTTGG + Intronic
1156693843 18:39742223-39742245 CCTCCATTTCCCTAGCCACAGGG - Intergenic
1157136495 18:45061977-45061999 ACTCCATGGCTCCACCTTCAAGG - Intronic
1157141440 18:45111113-45111135 CCTCCCTGTTCCCAGCCTCCAGG - Intergenic
1157564097 18:48668156-48668178 CCTCCACCTGCCCACCCCCAGGG + Intronic
1158490765 18:57907475-57907497 TCTCCATGCCTCCATCCTCAGGG - Intergenic
1158742674 18:60161738-60161760 CCTCCAGGTTCCCTCCCTCAAGG - Intergenic
1159776054 18:72604049-72604071 TCTCCTAGACCCCACCCTCAGGG - Intronic
1159879339 18:73843891-73843913 CCTCCAAATCCCCACACTAAGGG + Intergenic
1160498339 18:79388188-79388210 CTTCCCGGTCCCCACACTCATGG + Intergenic
1160707448 19:536156-536178 CCTCCACGTCCTCATCCTCCGGG + Intronic
1160745094 19:707750-707772 CCCCCCTGCCCCCACCCTTAAGG - Intergenic
1160891414 19:1380662-1380684 CCTCCATGTTCCCTGTCTCAGGG + Intergenic
1160972463 19:1775642-1775664 CCTCCATGCCCACTCCCTCCAGG + Exonic
1161010121 19:1955848-1955870 CCTCCCTGTGCCCGGCCTCAGGG - Intronic
1162022247 19:7873277-7873299 CCTCCAGGCCCCCAGCCTCTGGG - Exonic
1162105691 19:8368385-8368407 GCTCCTTGTCCCCAGCCTCATGG + Intronic
1162325374 19:9996119-9996141 CCTCCATCTCTCCTCCCCCAAGG - Exonic
1162805808 19:13137456-13137478 CCTCCATGTCCCCTGCCCCCAGG + Exonic
1163031637 19:14548320-14548342 CCTGCATTTCCCCACCCCCTTGG + Intronic
1163548127 19:17951199-17951221 CCTCCCTGTCCCCTGCCTGAAGG + Intergenic
1164230572 19:23284073-23284095 CCTGCATCTCCCCAGTCTCACGG - Intergenic
1164645347 19:29855272-29855294 CCTTCATCTCCCCAGCCTCCGGG - Intergenic
1165040705 19:33065531-33065553 CCTCCTGGTCCCCTCTCTCAGGG - Intergenic
1165206212 19:34189066-34189088 TATTTATGTCCCCACCCTCAGGG - Intronic
1165327116 19:35120656-35120678 CCACCATGTCCACACCCACCTGG - Intronic
1165790401 19:38488154-38488176 CAACCATCCCCCCACCCTCATGG + Intronic
1165790706 19:38490039-38490061 CCTCCATCTCTCCTCCCACACGG + Intronic
1166014889 19:39972202-39972224 CCTCCAGGTCCTCAGGCTCAGGG - Exonic
1166158550 19:40934399-40934421 CCTCCACTTCCCCACGCTCAAGG + Intergenic
1167215473 19:48161507-48161529 CCCCCATTTCCCCACCTTCCAGG - Exonic
1167259983 19:48452848-48452870 CCTCCACGTCGCCCGCCTCAGGG - Exonic
1167521856 19:49960077-49960099 CCTCCACCTCCCCACCCACCGGG + Intronic
1167523528 19:49970645-49970667 CCTCCACCTCCCCACCCACCGGG - Intergenic
1167756538 19:51416606-51416628 CCTCCACCTCCCCACCCACCGGG + Intronic
1168135730 19:54349822-54349844 CCTCCATCCATCCACCCTCAGGG - Intergenic
1168277407 19:55285302-55285324 ACTCCCTGTCCCAACACTCAAGG - Intronic
1168327445 19:55545498-55545520 CCTCTGGGTCCCCATCCTCAGGG + Exonic
925218444 2:2117378-2117400 CCTGGACGTCTCCACCCTCAGGG + Intronic
926143695 2:10384171-10384193 TCACCTTGTCCCCACCCTGAGGG - Intronic
926619821 2:15037342-15037364 TCACCCTGTCCCCACCCGCAAGG + Intergenic
926908425 2:17827346-17827368 CCTCCACCTTCCCTCCCTCAAGG - Intergenic
927337337 2:21940508-21940530 CCTGCATCTTCCCACCTTCATGG - Intergenic
927685756 2:25169183-25169205 CTTCCGTGTCCCAAGCCTCAAGG + Intergenic
928753171 2:34494350-34494372 CCACCAAGTCCCCACCCACCCGG - Intergenic
929918359 2:46154590-46154612 CCTCCTTGTCCTCGCCCTCTGGG + Intronic
929924637 2:46198071-46198093 TCTCCATGTCCCTATCCTCATGG + Intergenic
930022152 2:47008017-47008039 CCTTCCTGTCCCCATCCCCACGG - Intronic
931008064 2:57875447-57875469 CTATCATGTCCCCACACTCAAGG + Intergenic
931244379 2:60480168-60480190 CCTTCATGTCCCCAGCCCCCTGG - Intronic
932474424 2:71992964-71992986 CCTCCATCTCCCCACAGTCAAGG + Intergenic
933685690 2:85139722-85139744 CCTCCATGTCTTCACTCTCCTGG - Intronic
934614607 2:95763317-95763339 AGACCAAGTCCCCACCCTCATGG - Intergenic
936079718 2:109423892-109423914 CCTCCATTTCCCCACCTGCTTGG - Intronic
936149968 2:110011297-110011319 CCTCCATGTGCCTGCCCTGAGGG + Intergenic
936194708 2:110360072-110360094 CCTCCATGTGCCTGCCCTGAGGG - Intergenic
937209845 2:120261357-120261379 TCTCCTTGTCTCCAGCCTCATGG - Intronic
937280201 2:120712549-120712571 CCACCATCACTCCACCCTCAGGG + Intergenic
937967617 2:127526085-127526107 CCTCCTTGCCCCCACCCGCGGGG + Intronic
938053447 2:128195870-128195892 CCTCCAGGTCCTCAACCTCTGGG + Intergenic
939716820 2:145594400-145594422 CATCCAAGTCCACACCCTCATGG + Intergenic
940471303 2:154104195-154104217 CCACCATCCCCCCACCCCCATGG - Intronic
940635273 2:156291696-156291718 CCTCCTTCTCTCCACCATCAAGG + Intergenic
940707836 2:157126452-157126474 CCTCCAGGAGCCCATCCTCAGGG - Intergenic
941674026 2:168324826-168324848 CCTCGCTGCCTCCACCCTCAAGG + Intergenic
941917204 2:170820625-170820647 CCTCCTTGTCCCCAACCACTAGG + Intronic
942613265 2:177763563-177763585 CCTCCAGCTCCTCCCCCTCAGGG - Intronic
945915279 2:215697124-215697146 TCTGCATGTCCCCACCTTCTTGG - Intergenic
946327817 2:218993714-218993736 CCTCCCTGTCCCGGCCCTCGGGG + Intergenic
946907646 2:224431643-224431665 CCTCCATCTCCCCTGGCTCAGGG - Intergenic
948634868 2:239328580-239328602 CCACCAGCTCCCCACTCTCATGG - Intronic
948909877 2:240997815-240997837 CCTCTATGTCCCCAGGCCCATGG - Intergenic
1170287449 20:14725750-14725772 CATCTATGTCCTCACCCTCTGGG - Intronic
1171389159 20:24790118-24790140 CCTGCTTGTCCCCACCCCGATGG - Intergenic
1171720965 20:28562921-28562943 CCACCATGTCCTCAGCCTAATGG - Intergenic
1171757102 20:29120634-29120656 CCACCATGTCCTCAGCCTAATGG + Intergenic
1172007876 20:31829934-31829956 CCTCCTGGGTCCCACCCTCAGGG - Intronic
1172229944 20:33329913-33329935 CCTCCCTGTGCCCAACATCAGGG + Intergenic
1172597413 20:36159016-36159038 CCTCCAAGTCCCCACAGTTAAGG - Intronic
1172648428 20:36486201-36486223 ACTCAAGGTCCCCACCATCAGGG + Intronic
1173036014 20:39411320-39411342 TCTCCATGTCCCCAACAACAGGG + Intergenic
1173152807 20:40582251-40582273 CTTCCATGTCCTCACCCTAAGGG + Intergenic
1175091500 20:56508066-56508088 TCTCTATGGCACCACCCTCAGGG + Intronic
1175392784 20:58637604-58637626 CCTCCAGGTCCCAACCAGCAGGG - Intergenic
1175402463 20:58708353-58708375 CCTCCGTGTCCCCACCGGCTGGG - Intronic
1175832249 20:61971786-61971808 CCACTGTGTGCCCACCCTCAGGG - Intronic
1179517683 21:41919996-41920018 CCTCCACGTCCACACCCGCAGGG - Intronic
1179582406 21:42352034-42352056 CCTCCAGGCCCCCATCCTCTAGG + Intergenic
1179582438 21:42352136-42352158 CCTCCAGGCCCCCATCCTCCAGG + Intergenic
1179818371 21:43922426-43922448 CCTCCTTAACCCCACCCTCAAGG + Intronic
1179818387 21:43922482-43922504 CCTCCTTAACCCCACCCTCAAGG + Intronic
1180101496 21:45589884-45589906 CCTACACGTCCCCGGCCTCAAGG - Intergenic
1180159492 21:45992727-45992749 CCTCCATGTCTCTCCACTCAGGG + Exonic
1180820415 22:18823386-18823408 CCTCCAGGACCCCAGCCTCAGGG - Intergenic
1181162767 22:20967652-20967674 CCTCCAGGGCCCCACGCTCTGGG + Intronic
1181206639 22:21257858-21257880 CCTCCAGGACCCCAGCCTCAGGG - Intergenic
1181455872 22:23059848-23059870 CCAACATGCCCTCACCCTCAGGG + Intronic
1182686929 22:32128289-32128311 CCTCCAGGGCCCCACCCCCAGGG - Intergenic
1183414418 22:37674374-37674396 CCTCCCAGTCCCCACTCTCAAGG - Intergenic
1184225986 22:43129104-43129126 CTTCCCAGTCCCCACCCTCCTGG + Intronic
1184378596 22:44130980-44131002 CCACCAAGACCCCAGCCTCAAGG - Intronic
1184578267 22:45392669-45392691 CCTCCATATCCACACTTTCATGG - Intronic
1184636906 22:45839906-45839928 CCGCCATGGCCCCACCCACGTGG + Intronic
1184689842 22:46112545-46112567 CCACAATGTCCCCACTCCCAGGG + Intronic
1185072702 22:48666024-48666046 TCTCCCAGTCCCCACCCTCCTGG - Intronic
1185089009 22:48755607-48755629 CCTCCCTGTCCCCCCGCTCCTGG + Intronic
1185336226 22:50271913-50271935 CCTCCATGTCCCCCACCCTAGGG - Intergenic
1203220283 22_KI270731v1_random:37565-37587 CCTCCAGGACCCCAGCCTCAGGG + Intergenic
1203270542 22_KI270734v1_random:49261-49283 CCTCCAGGACCCCAGCCTCAGGG - Intergenic
949407990 3:3734685-3734707 TCTCCATTTCCCCTCCCTCCAGG - Intronic
949786703 3:7749485-7749507 CCTCCATGTCGACAGCCTAATGG + Intergenic
950475249 3:13210769-13210791 TCTCCCTGTGCCCACCCTGATGG + Intergenic
950527482 3:13532881-13532903 CCCCAATGTCTCCAGCCTCAGGG - Intergenic
950798493 3:15530657-15530679 CCTCCTTCTCCCCAGCCTCCAGG + Intergenic
951455377 3:22886401-22886423 CCTCCATGTCTCTTCCCTCTTGG - Intergenic
952037577 3:29221198-29221220 CCTCCATGCCCAGAACCTCAAGG + Intergenic
952947406 3:38487610-38487632 CAGCCACCTCCCCACCCTCACGG - Exonic
953228502 3:41043039-41043061 CCTCCATATCTCCAGCCTCCTGG + Intergenic
953414422 3:42707478-42707500 CCTCCATAGCCCCATCCCCAAGG + Intronic
953414464 3:42707730-42707752 CCTCCATGTGTGCACACTCATGG - Intronic
953870997 3:46627577-46627599 CCTTCCTGACCCCACCCTCCAGG - Intergenic
954150147 3:48653224-48653246 CCTCCAAGTCCCAGCCCACATGG - Intronic
954467564 3:50665382-50665404 CCACCCTGCCCCCACCCCCAAGG + Intergenic
954593313 3:51802647-51802669 CCTCCCTAACCCCACCCACAAGG - Intergenic
954698447 3:52439764-52439786 CCTCCCTGGCCCCAGACTCAGGG - Exonic
956793185 3:72695515-72695537 CCTCCATCTGTCCACCCTGAAGG + Intergenic
959440954 3:106374915-106374937 CCTCCATGTCCTTTCCCACATGG + Intergenic
961279914 3:125758362-125758384 TCTCCAAGTCCCCACCATAATGG + Intergenic
961739015 3:129020892-129020914 CCTCCAAGTCCAAACCCACAGGG + Intronic
963093106 3:141505065-141505087 CCTCCCTGTCTCTACCCTCTGGG + Intronic
967102907 3:186230841-186230863 CCACCAGGTCCCCACCCAGATGG - Intronic
968288068 3:197519771-197519793 CCTCCCTGTCCCCACCCCAGGGG - Intronic
968591111 4:1460099-1460121 CCTCCAGGACCCCAGCCCCAGGG - Intergenic
968623912 4:1618039-1618061 CCTCCATCTTCCCATCTTCACGG - Intronic
968625652 4:1625597-1625619 CCCCCATGTCCCGACCCACGTGG + Intronic
969463095 4:7339120-7339142 CCCTCCTGTCCCCACCCTCACGG - Intronic
969477109 4:7427940-7427962 CCTCCATCCCCCCGCCCTCAGGG - Intronic
969494189 4:7516551-7516573 CCTCCAGGTCCCTGCCCACATGG - Intronic
969705464 4:8789074-8789096 CCTCCATGTCTCCCTCCTCCCGG - Intergenic
971292332 4:25355434-25355456 ACTCCCTGACCCCACCCCCATGG - Intronic
972340934 4:38151894-38151916 CTTGCATGTCCCCACCCTGCCGG - Intergenic
974302757 4:60090077-60090099 CCTCCCTATCTCCACCCTCAGGG + Intergenic
975040766 4:69742864-69742886 CCAGCATGGCCCCAGCCTCATGG + Intronic
976119117 4:81760763-81760785 CCTCCATATCCCCTCCCTTTTGG + Intronic
978267789 4:106847426-106847448 ACTCCATGTTTCCACACTCATGG + Intergenic
983092661 4:163523136-163523158 CCTCCATATCCCCATGCTCTGGG - Intergenic
984481320 4:180306632-180306654 CCTCCCACTCCCCACCCTCTGGG + Intergenic
985620767 5:953827-953849 CCTCCATGACGGCAACCTCAGGG - Intergenic
985760489 5:1746325-1746347 CCTCCTTGGCCCAGCCCTCAGGG - Intergenic
986392192 5:7297547-7297569 ACACAATGTCCCCACCCACAGGG + Intergenic
986427905 5:7653078-7653100 CCTCCCTGTCTACACCCACAGGG - Intronic
986690295 5:10308073-10308095 CCTCCCTGCCTCCTCCCTCAAGG - Intergenic
986708819 5:10472704-10472726 CCCCCAAATCCCCACCCTCCTGG - Intergenic
987306033 5:16638735-16638757 CCACCTTGGCTCCACCCTCAGGG + Intergenic
988693896 5:33599494-33599516 CCTCCATTTCCCAAATCTCATGG - Intronic
989163693 5:38414805-38414827 ACTCCATGGACCCCCCCTCAAGG + Intronic
990287217 5:54311664-54311686 CCCCCCCATCCCCACCCTCAGGG + Intergenic
997597078 5:135114201-135114223 CCTCAAGGTCCCCAGCCTCGTGG - Intronic
998406897 5:141878974-141878996 CCTCCATAGCCCCACCCCCACGG - Intronic
999015575 5:148100590-148100612 CCTCCATGTTCCCAGCTGCAGGG - Intronic
1000073988 5:157767729-157767751 CCTCCATTTGGCCACCCTCAAGG - Intergenic
1000211161 5:159106995-159107017 CCTCCAGCTTCCCTCCCTCATGG + Intergenic
1001052473 5:168424084-168424106 CCTCCTGGTTCCCACCCTCTGGG - Intronic
1002637856 5:180617040-180617062 CCTCCATCTACCCAGCCCCAGGG + Intronic
1002644206 5:180645274-180645296 CCTCCTGGTCTCCACCCCCACGG - Intronic
1003051372 6:2783596-2783618 TAGCCATTTCCCCACCCTCATGG - Intronic
1004116210 6:12770508-12770530 CCTCCATGTCCCTCCACACATGG - Intronic
1006373316 6:33658598-33658620 CCCCCATATCCCCTCCCTAATGG + Intronic
1006450720 6:34104266-34104288 GCTCCATGTCCCCAGCCCCGGGG - Intronic
1006513525 6:34533946-34533968 CTTCCAGCTCCCCGCCCTCATGG - Exonic
1006535724 6:34697064-34697086 CCGCCCCGTCCCCACCCTCAAGG + Intergenic
1006644853 6:35509117-35509139 GCTCCAAGCCCCCACCCTCTAGG + Intronic
1007682687 6:43645351-43645373 CCTCCAGGTAGCCACCCTCTGGG - Intronic
1007735962 6:43982324-43982346 TCTCCATGTGCCCCCCATCAAGG - Intergenic
1010045114 6:71432788-71432810 CCTCCATCTCCCCGGGCTCAGGG + Intergenic
1011281455 6:85681921-85681943 CCTCCAACCCTCCACCCTCAAGG + Intergenic
1011820250 6:91244980-91245002 CCTCTATGTCCCCAAACTCTAGG - Intergenic
1017456335 6:154604483-154604505 CCTCCCTGTCCCCTCCCAGATGG + Intergenic
1018742548 6:166741687-166741709 CCTCCAGGGCCCCGCCTTCAAGG + Intronic
1019318856 7:405813-405835 CCCCCATGCCCCCATCCTCGGGG + Intergenic
1019450001 7:1092622-1092644 CCGCCATGCCCACCCCCTCACGG + Exonic
1019488527 7:1300486-1300508 CCTCGGTGTCTCCACACTCAGGG - Intergenic
1019817177 7:3209887-3209909 CCTCCCACTCTCCACCCTCAAGG + Intergenic
1021669639 7:23022527-23022549 CCTCCATGTGCCCGGCCTGAAGG + Intergenic
1022329760 7:29366421-29366443 CTTCCATGGCACCACCCTCCTGG - Intronic
1022484908 7:30771002-30771024 CTTCCTTGCCCCCACCGTCAAGG + Intronic
1023958337 7:44905820-44905842 CCTGGCTGTCCCCACCATCAGGG + Intergenic
1024064968 7:45725022-45725044 CCTCCTTGCCCCCAGCCTGATGG + Intergenic
1024342945 7:48285456-48285478 CCTCAAAGGCACCACCCTCAAGG - Intronic
1025320177 7:58087184-58087206 CCTTCATGTCCCCACCGTCGTGG + Intergenic
1025561230 7:62376958-62376980 GCTTCATGTCCCCGCCGTCATGG + Intergenic
1027228500 7:76259691-76259713 CCTACAGGTCCCCGACCTCACGG - Intronic
1027264644 7:76487671-76487693 TCTCCAAGTCCACACCCTCTGGG - Intronic
1027316016 7:76985773-76985795 TCTCCAAGTCCACACCCTCTGGG - Intergenic
1028860690 7:95646840-95646862 CCTCCCTTTCTCCACCCTCAAGG + Intergenic
1029076239 7:97936507-97936529 TCTCCAAGTCCCCACCATAATGG - Intergenic
1031136913 7:117894724-117894746 CCTCCACCACCCCACCCTCCAGG + Intergenic
1031189658 7:118531395-118531417 CCTCTATGTCCTCAACTTCAAGG - Intergenic
1031975873 7:128093233-128093255 CCACCATGGCTCCTCCCTCATGG - Intergenic
1032274065 7:130439526-130439548 CCTCCTTCCCCCCACCCTCCAGG + Intronic
1032398653 7:131608478-131608500 CCACCATGCCCCTACCCCCATGG - Intergenic
1033657378 7:143382536-143382558 CCTCTATCCCCCCACCCCCAAGG - Intronic
1034944276 7:155251873-155251895 CCTCCTGGTCCCCTCCCTGATGG + Intergenic
1036477416 8:9105849-9105871 CCTCCAAGTCCCCTAACTCAGGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1036831451 8:12023227-12023249 TCTCCAAGTCCCCACCATAATGG - Intergenic
1038611279 8:29061864-29061886 CCGCCCTGTGCCCACCCTCAAGG - Intronic
1039365366 8:36923076-36923098 CCTCCATGTTCCTCCTCTCATGG + Intronic
1040011418 8:42664157-42664179 CCTCCAGGTTCCCTGCCTCAAGG + Intergenic
1041586137 8:59522079-59522101 CCTCCCCCTCTCCACCCTCAAGG - Intergenic
1042011642 8:64252483-64252505 CCTCCCTGTCATCTCCCTCAAGG - Intergenic
1043823473 8:84896686-84896708 TCTCCTTGTCCCCACATTCAGGG - Intronic
1044525586 8:93247249-93247271 CCTCCATATGCCCTCCCTAAAGG + Intergenic
1045442581 8:102228715-102228737 CCTGCATGCTCCCTCCCTCAAGG + Intronic
1045701404 8:104870869-104870891 CCTGCTTGTCCCCGCTCTCATGG + Intronic
1047226557 8:122960066-122960088 CCAGCATGTCCCTGCCCTCATGG + Intronic
1047359897 8:124159721-124159743 TAACCATGTCCCCAACCTCATGG + Intergenic
1048043501 8:130752490-130752512 ACTCCTTGTCCCCACCCCCAGGG - Intergenic
1048531868 8:135257105-135257127 CCTCCACTTCCCTACCCTCCAGG - Intergenic
1048609068 8:136002169-136002191 CCTCCATCTCCTCACCCCAAAGG + Intergenic
1049007684 8:139866001-139866023 CCCCCATGTCCCCACCCCTTTGG - Intronic
1049242794 8:141546949-141546971 CATCCACGTCCCCACCCTTGGGG - Intergenic
1049595943 8:143483418-143483440 CCTGCATTGCCCCAGCCTCACGG - Intronic
1049762836 8:144338663-144338685 CCTCTCTGTCCCCACTCTCCGGG + Intergenic
1051132561 9:13878607-13878629 CCTCCATTCCCCCCCCATCACGG - Intergenic
1052987944 9:34501764-34501786 CCCCCATGCCCCCACCCACCCGG - Intronic
1053504486 9:38629918-38629940 CCTCCATAGCCCCTCCCTCCAGG + Intergenic
1056454410 9:86746171-86746193 CAACCATGCCCCCACCCACAGGG - Intergenic
1056769507 9:89466623-89466645 CCTGCATGTGCACACTCTCAAGG + Intronic
1057151932 9:92803763-92803785 CCTCCATAGCCCCTCCCTCCAGG - Intergenic
1057620348 9:96629070-96629092 CCCCCAGGTCTCCTCCCTCAGGG + Intergenic
1058003298 9:99889432-99889454 CATCCATGTCGAGACCCTCAAGG + Intergenic
1060014255 9:120072674-120072696 ACCCCATCTCCCCACCCTCAAGG - Intergenic
1060583511 9:124771664-124771686 CCTCCAGGGCCCCGCCCACAGGG - Intergenic
1060952580 9:127613045-127613067 CCTCCTCCTCCCCACCCTCCTGG + Intronic
1061179265 9:129014243-129014265 CCTCTCTGTCCCTGCCCTCAAGG - Intronic
1062013935 9:134281871-134281893 CCCCCATGTCCCCCACCCCAGGG - Intergenic
1062345893 9:136115115-136115137 AATCCATGTCCCCACACTCTGGG - Exonic
1062403098 9:136381004-136381026 CCTGGATGTCCACAGCCTCATGG - Intronic
1062476908 9:136732773-136732795 CCAGAATGTCCCAACCCTCAGGG - Intergenic
1062559874 9:137136742-137136764 CCTCCCTGACCCCAGCCTCGCGG - Intergenic
1062561936 9:137145594-137145616 CACCCCTGTCCCCACCCCCATGG - Intronic
1062580777 9:137228366-137228388 GCTCCAGGCCCCCACCCTCCTGG - Intronic
1185550676 X:980840-980862 CCTCCATCATCCCAGCCTCAGGG - Intergenic
1186417727 X:9398312-9398334 TCTCCATTTCCCCACCCGAATGG + Intergenic
1186444736 X:9617595-9617617 CCCTCATGTCCCCACTCTCTGGG - Intronic
1189386870 X:40544460-40544482 TCTCCATACCCCCTCCCTCAGGG + Intergenic
1191250700 X:58258832-58258854 CCTCAATGTCCCCTTCCTCCCGG - Intergenic
1191251464 X:58262036-58262058 CCTCAATGTCCCCTTCCTCTGGG - Intergenic
1192467953 X:71371037-71371059 CCACCATGTCCCCCCAGTCAGGG - Intronic
1193763423 X:85494923-85494945 TCCCCAAGTCCCCATCCTCATGG - Intergenic
1194215285 X:91123695-91123717 CCTCCATGAGCCACCCCTCAGGG - Intergenic
1194320192 X:92436811-92436833 CCTCCAAAACTCCACCCTCAAGG - Intronic
1195467676 X:105197910-105197932 CCTCCCACTCTCCACCCTCAAGG + Intronic
1195680198 X:107539979-107540001 CCTCCCTGTCCCCATCCTTCAGG - Intronic
1199926108 X:152465775-152465797 CCTCCATGGCCCCAGGCTCCAGG + Intergenic
1200628314 Y:5549943-5549965 CCTCCAAAACTCCACCCTCAAGG - Intronic