ID: 1132497515

View in Genome Browser
Species Human (GRCh38)
Location 16:270861-270883
Sequence GCCCTGGCTGCCACTCTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 171}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132497515_1132497524 -4 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497524 16:270880-270902 GGGCCGGTGGGGGGTTCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 298
1132497515_1132497534 22 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497534 16:270906-270928 TGGTGGAAACCGAGGCGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165
1132497515_1132497532 18 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497532 16:270902-270924 GAGCTGGTGGAAACCGAGGCGGG 0: 1
1: 1
2: 3
3: 20
4: 266
1132497515_1132497535 23 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497535 16:270907-270929 GGTGGAAACCGAGGCGGGAGGGG 0: 1
1: 0
2: 2
3: 25
4: 427
1132497515_1132497536 30 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497536 16:270914-270936 ACCGAGGCGGGAGGGGTCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1132497515_1132497533 21 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497533 16:270905-270927 CTGGTGGAAACCGAGGCGGGAGG 0: 1
1: 0
2: 3
3: 90
4: 3079
1132497515_1132497530 14 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497530 16:270898-270920 CAGGGAGCTGGTGGAAACCGAGG 0: 1
1: 0
2: 1
3: 26
4: 288
1132497515_1132497527 5 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497527 16:270889-270911 GGGGGTTCCCAGGGAGCTGGTGG 0: 1
1: 0
2: 4
3: 86
4: 572
1132497515_1132497526 2 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497526 16:270886-270908 GTGGGGGGTTCCCAGGGAGCTGG 0: 1
1: 1
2: 3
3: 39
4: 474
1132497515_1132497523 -5 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497523 16:270879-270901 AGGGCCGGTGGGGGGTTCCCAGG 0: 1
1: 0
2: 2
3: 21
4: 278
1132497515_1132497531 17 Left 1132497515 16:270861-270883 CCATCGAGAGTGGCAGCCAGGGC 0: 1
1: 0
2: 2
3: 21
4: 171
Right 1132497531 16:270901-270923 GGAGCTGGTGGAAACCGAGGCGG 0: 1
1: 0
2: 1
3: 25
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132497515 Original CRISPR GCCCTGGCTGCCACTCTCGA TGG (reversed) Intronic
900192376 1:1356899-1356921 GCCCTGGCTTCCCCACTCAAGGG - Intronic
900471038 1:2855073-2855095 GCCCTGGCTCCCCCTCCCGGAGG + Intergenic
900546219 1:3230728-3230750 GCCCTGCCTGCCTGTCTCGCTGG + Intronic
901131533 1:6964511-6964533 GCCATGGCTGCCTCTCTCCCAGG + Intronic
901649897 1:10737442-10737464 GTCCTGGCTGCCCCGCTGGAGGG + Intronic
902246319 1:15123279-15123301 GTCCTAGCTGCCACTCACTAAGG - Intergenic
904620028 1:31769826-31769848 GCCCTGGCAGCCATTCCAGACGG + Intergenic
905951782 1:41958126-41958148 GCCCTGGGTGCCACTCAAAATGG - Intronic
912726276 1:112061405-112061427 GCCTTGGGTGCCCCTCTTGAAGG + Intergenic
916212099 1:162367561-162367583 GCCCTGGCTGGCATTCTCCTCGG - Exonic
917802094 1:178580650-178580672 GCCCTGTTTGCCACACTCCAGGG - Intergenic
918651141 1:186964899-186964921 TCCCAGGCTGCCTCTCTTGAGGG - Intronic
919829921 1:201533025-201533047 CCCCTGTCTACCACTCTCCAGGG + Intergenic
922614792 1:226955363-226955385 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614797 1:226955379-226955401 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614802 1:226955395-226955417 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614806 1:226955411-226955433 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG + Intronic
922614820 1:226955475-226955497 TCCCTGGCTGCCACTCTCTCTGG + Intronic
922614829 1:226955521-226955543 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614857 1:226955630-226955652 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614872 1:226955678-226955700 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614885 1:226955724-226955746 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614901 1:226955786-226955808 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614923 1:226955880-226955902 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614953 1:226956004-226956026 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614964 1:226956052-226956074 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614998 1:226956196-226956218 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615009 1:226956242-226956264 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615017 1:226956274-226956296 TCCCTGGCTTCCACTCTCCCTGG + Intronic
922615030 1:226956338-226956360 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615054 1:226956434-226956456 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615065 1:226956480-226956502 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615081 1:226956542-226956564 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615103 1:226956636-226956658 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615114 1:226956682-226956704 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615156 1:226956868-226956890 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615178 1:226956962-226956984 TCCCTGGCTGCCACTCTCCCTGG + Intronic
1063898759 10:10710110-10710132 GCCCTGACTGCCACTTTGCAAGG + Intergenic
1064171965 10:13041785-13041807 GCCCTGGCAGCGAATCTTGATGG + Intronic
1066064158 10:31750269-31750291 GCACTGGCTCCCACTCTCAGAGG + Intergenic
1066652663 10:37673084-37673106 GCTCTGGCTGCCACTCTAGAAGG + Intergenic
1068171825 10:53404191-53404213 ACCGTGGCTGCCACACTCCAGGG - Intergenic
1069625655 10:69866311-69866333 GCCCTGGCTCCCACTGTGGCAGG - Intronic
1070960966 10:80499962-80499984 GCCCTGGCTGCCAATCTTCTGGG - Intronic
1076483729 10:130802068-130802090 GCCCTGGCTGCCATTCCCAACGG - Intergenic
1081861163 11:46333997-46334019 GCCCTGGCTGGCAACCTCCAGGG + Intronic
1082249292 11:49961425-49961447 GCTCAGGTTGCCACTCTAGAGGG + Intergenic
1082561672 11:54626922-54626944 GCTCAGGTTGCCACTCTAGAGGG - Intergenic
1083959824 11:66008442-66008464 GGCCTGTCTGCCACTCACCAAGG - Intergenic
1084945504 11:72636151-72636173 GCCCTGCCGGCTACTCTCAAGGG + Intronic
1085483019 11:76838254-76838276 GCCCTGGCTTCCATTCTCAGTGG + Intergenic
1085638234 11:78174420-78174442 GCCCTGGCTGTCCCTCTTGGTGG + Exonic
1089218844 11:116853862-116853884 TCCCTGCCTGCCACCCTAGAAGG - Intronic
1089354172 11:117839103-117839125 GTCCGGGCTGTCACTCTCCACGG + Intronic
1089619483 11:119714162-119714184 GCCCTGGCTGCCCCTCAATAGGG - Intronic
1089622196 11:119728568-119728590 GCCCTCGCCGCCCCTCTCGCCGG - Exonic
1092029942 12:5275584-5275606 GGCCTGGCTCCCACCCTCTAGGG - Intergenic
1092231713 12:6779332-6779354 GCCCTGGCTGGCCCTCTCAAGGG + Intergenic
1095396663 12:41769838-41769860 TCTCTGTCTGCCACTCTGGATGG - Intergenic
1103914678 12:124370125-124370147 GCCCTGGCTGCCTGCCTCCAGGG + Intronic
1104482000 12:129115714-129115736 GCCCTGGCTTCCACTGGCGTAGG - Intronic
1104671850 12:130686133-130686155 GCCGTGACTGCCAGTCTCCAGGG - Intronic
1104726212 12:131077198-131077220 GCCCTGGCTGTCCCCCTCGAGGG + Intronic
1108510219 13:51148853-51148875 GCCCTGGCTGCCCACCTCAAAGG + Intergenic
1112507617 13:99984657-99984679 GCCCTGCCTGCCTTTCTAGAGGG - Intronic
1113957654 13:114107912-114107934 CCCCTGAGTGCCACTCTCCACGG + Intronic
1114675534 14:24437656-24437678 TCCCTGGCTGCTGCTCTGGATGG + Exonic
1116439856 14:44939102-44939124 GCTCAGGCTGCTACTCTAGAAGG - Intronic
1119223978 14:72929926-72929948 GCCATGGCTGCTGCTCTCCATGG + Intronic
1121113869 14:91330406-91330428 GCCTTTGCAGCCACTCTCCATGG - Intronic
1122087697 14:99318866-99318888 GGCCTGGCTGCCTCTCCCCAGGG + Intergenic
1122287060 14:100658434-100658456 GCCCTCACTGCCACTCCCCAGGG - Intergenic
1122780245 14:104140429-104140451 GCTCTGGCTGGCCCTCTCCAGGG - Intronic
1122918577 14:104870175-104870197 TCCCTGGCTGCCCCTCACCACGG - Intronic
1123099677 14:105788237-105788259 GCTCAGGCTGCCACTCCAGAAGG + Intergenic
1123992530 15:25694180-25694202 GCCCTGTCTGCTCCTCTCCAGGG - Intronic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG + Intronic
1125599914 15:40909853-40909875 GGCCTGGCTGGCACTCTCCCGGG + Intergenic
1129516171 15:76159051-76159073 GGCCTGGCTGCAGCTCACGAAGG + Intronic
1130835557 15:87646270-87646292 GCCCTGGCTCCCTCTCTTAAGGG + Intergenic
1132497515 16:270861-270883 GCCCTGGCTGCCACTCTCGATGG - Intronic
1137031344 16:35527032-35527054 GCCCTGGCTGCCTCTCTATTAGG + Intergenic
1141427077 16:83951637-83951659 CTCCTGTCTGCCACCCTCGAGGG - Intronic
1141546934 16:84776571-84776593 GACCTGGGTGCCACACTCCAAGG - Intronic
1143472336 17:7183782-7183804 GCCCTGACTGCAACTCTTTATGG - Intergenic
1143864801 17:9916268-9916290 GCCCTGGCCCCCACTCTCCCGGG - Exonic
1144877977 17:18412242-18412264 GCCCTGGCAGCGACTCTCCTGGG - Intergenic
1145154252 17:20532183-20532205 GCCCTGGCAGCGACTCTCCTGGG + Intergenic
1146978938 17:37141365-37141387 GCCCTGGATGCCACTGCCAAAGG + Intronic
1147198014 17:38780560-38780582 ACCCTGGCTGTCACTGTTGATGG + Exonic
1147718442 17:42523084-42523106 GCCCAGCCTGCCACCCTGGACGG - Intergenic
1148858718 17:50593083-50593105 GCCCTGGCTGCCCCACAGGAGGG - Intronic
1150481459 17:65514750-65514772 GCCCTGCCTGGCACTCACGCTGG - Intergenic
1150487835 17:65556301-65556323 GCTCTGGCTGCCAGGCTAGAGGG + Intronic
1151415611 17:73960736-73960758 GCTCTGGCCACCACTCTAGAGGG + Intergenic
1151673938 17:75588557-75588579 GCGCTGGCTGCCGCTCTCCTGGG - Intergenic
1151869786 17:76828524-76828546 GTCCAGGCTGCCTCTCTCCATGG + Intergenic
1155300652 18:24426467-24426489 CCTCTGGCTGCAACTCGCGAGGG + Intergenic
1155404961 18:25477731-25477753 TTCCTGGCTGCCAATCTCAATGG + Intergenic
1156077728 18:33301164-33301186 GTTTTGGCTGCCACTCTGGAGGG + Intronic
1157845334 18:50998996-50999018 GCCCTGGCCCCCAATCTAGAAGG - Intronic
1158514387 18:58119230-58119252 TCCCAGGCTTCCACTCTCCATGG - Intronic
1159218477 18:65428427-65428449 ACTCTGGCTGCCACTCTGGAGGG + Intergenic
1160227829 18:77024962-77024984 GCCCTCTCTGCCACTCTCTGCGG - Intronic
1162056271 19:8065966-8065988 GCCCTGGCTGCCCCTCTGGCTGG + Exonic
1162116207 19:8430962-8430984 TCCCTGGCTGCCTCTGTCTATGG + Intronic
1162301342 19:9846890-9846912 GGCCTGGCAGCCACTCTCCAGGG - Intronic
1162310956 19:9906993-9907015 TCCCCGGCTGCCACTCAGGAGGG - Intronic
1163145977 19:15379573-15379595 GCCCTGGCCGCCTCTCCGGAGGG + Intronic
1164846583 19:31437871-31437893 TCCATGGCTGCCACTCACCATGG + Intergenic
1166794677 19:45419371-45419393 GCCCTGGCTGCCAATCCCTGCGG - Intronic
1166996159 19:46720564-46720586 GCCCTGGCCGCCACGCTGGCTGG - Exonic
1167457069 19:49601839-49601861 GCCCTCTCCGCCACTCTCGCCGG - Exonic
1168616302 19:57839779-57839801 GCCCAGGGTGCCACTCTTTAGGG - Intronic
1168620566 19:57876253-57876275 GCCCAGGGTGCCACTCTTTAGGG + Intronic
925201334 2:1969588-1969610 GCCCCGCCTCCCACTCTGGACGG + Intronic
927478525 2:23432696-23432718 GCCCTGGCTGCCTCTCTTGCAGG - Intronic
928024492 2:27728654-27728676 GCCCTTGCTACCCCTCTCCAAGG + Intergenic
930490095 2:52058507-52058529 GCTCAGGCTGACACTCTGGAGGG + Intergenic
931239207 2:60437613-60437635 GCCCTGGGTGCCTCTCTCTGAGG - Intergenic
933998295 2:87686047-87686069 GCCCTGACTGCCACTCACCTGGG + Intergenic
934572738 2:95382900-95382922 GCCCTGGCTGCCTCTCAGGGAGG + Intronic
935201334 2:100859301-100859323 GACCTGGCTTCCACTCTTGGAGG - Intronic
935426013 2:102918932-102918954 GCCCTGGGTCCCACTTTCTAAGG - Intergenic
936295554 2:111264826-111264848 GCCCTGACTGCCACTCACCCGGG - Intergenic
948856183 2:240731754-240731776 GCCCTGGCTGACACTGTCGCTGG + Intronic
1169635689 20:7689169-7689191 GCTCAGGCTGCCACTCTGGAGGG + Intergenic
1172303992 20:33868774-33868796 CCCCTGCCTGCCACTCTCTCTGG + Intergenic
1173529226 20:43755848-43755870 GCGGTGGCTGCCTCTCTCGCTGG + Intergenic
1175248550 20:57595699-57595721 GGCCTGGCTGCCACTCGGGGAGG + Intergenic
1176130510 20:63494787-63494809 GCCCTAGCCGCCACTCACGTTGG + Exonic
1177406352 21:20673305-20673327 GCTCTGGCTGCAGCTCTAGAGGG + Intergenic
1178894191 21:36545092-36545114 GCCCTGCCTCCCTCTCTCCATGG - Intronic
1182170421 22:28223128-28223150 GCTCTGGCCGCCCCTCTCCATGG - Intronic
1183985725 22:41569108-41569130 GCCCTGCCTCCCTCTCTCTAGGG - Intronic
1184246182 22:43236954-43236976 GCCCTGGCTCCCACTGGCCAAGG - Intronic
1184380199 22:44140593-44140615 GCCCTGGCTGCCTGACTCTAAGG - Intronic
1184435643 22:44473492-44473514 GCTCAGGCTGCCACTCTAGAAGG + Intergenic
1184856465 22:47149163-47149185 GCCCTGACTGCAGCTCTGGAAGG - Intronic
1185213556 22:49585875-49585897 GCCCTGGTTTCCCCTCTCAAGGG - Intronic
950476540 3:13218706-13218728 CCCCTGACTGCCACCCTCAAGGG + Intergenic
952759617 3:36902531-36902553 GCCCTGAGTGCCACTCTTCATGG - Intronic
959708867 3:109364335-109364357 GTCCTGGCTGCTGCTCTCCAGGG + Intergenic
960627502 3:119695372-119695394 GCCCTGTTGGCCACTCTGGAGGG - Intergenic
961349619 3:126291606-126291628 GCCGGGGCTGCCACTCTCCCAGG + Intergenic
961627900 3:128276174-128276196 GCCCTGACTTCCACTGTCAAGGG - Intronic
962987451 3:140548477-140548499 TCCCTGACTGCCAGTCTCCAAGG - Intronic
963068008 3:141279200-141279222 GCCCTGGCTGCCATTCTGGATGG - Intronic
964720038 3:159762118-159762140 GCCCTGCCTGCCACTCCAGCGGG - Intronic
966242366 3:177768818-177768840 GCTCAGGCTACCACTCTGGAGGG - Intergenic
967577182 3:191107792-191107814 GCTCAGGCTGCCACTCCAGATGG + Intergenic
975912968 4:79290599-79290621 GCCCTGGCAGGCACTCTCCCAGG + Intronic
978206879 4:106090235-106090257 GCTCAGGCTGCCACCCTAGAGGG - Intronic
980075277 4:128287734-128287756 GCTCTCGCTGCCACTCCCCAGGG + Exonic
990382620 5:55231946-55231968 GCCCCGGCTGTCTCTCTGGAAGG - Intronic
991599070 5:68334633-68334655 GCCCTGTCACCCACTCTGGAGGG + Intergenic
995585289 5:113642412-113642434 GCTCAGGCTGCCACTCTGGATGG + Intergenic
997440823 5:133907526-133907548 GCCCTTGGTGCCTCTCTCGTTGG - Intergenic
999361393 5:150989321-150989343 GCCATGGCTGCCAATCTCATAGG - Intergenic
1000381107 5:160630244-160630266 GCCCTGGCTGGCAGTCCCAAAGG - Intronic
1002421908 5:179153353-179153375 GGACAGGCTGCCACTCTGGAGGG + Intronic
1006374017 6:33662137-33662159 GCCATGGCTGCCCCTCTCTCAGG - Intronic
1007614448 6:43171877-43171899 GCCCTCGCTGCCGCTGTAGAGGG - Exonic
1007752233 6:44077388-44077410 CCCCTGGCAGCCACCCTGGAGGG + Intergenic
1013803280 6:113970773-113970795 GCCCCGGCGCCCACTCGCGACGG + Intronic
1016437764 6:144055493-144055515 GCCCTGGGTGCCTCTATCGTAGG + Intronic
1017515469 6:155152368-155152390 GCCCTGCCTGCCCCTCTTAAGGG + Intronic
1017769798 6:157636121-157636143 GCCCTGGCTGACATTTTGGAAGG - Intronic
1019354570 7:571921-571943 GCCCTGGACGCCACTCTCACTGG + Intronic
1019446875 7:1075971-1075993 CCCGGGGCTGCCACTCTCCAGGG + Intronic
1019779215 7:2929793-2929815 GCCCCGGATGGCACTCTGGAGGG + Intronic
1020222233 7:6248487-6248509 GACCTGGCTTCCACTCCAGATGG + Intronic
1021840033 7:24714813-24714835 GCCTGGGCTGCCACTCTAGGTGG - Intronic
1027180285 7:75934763-75934785 GCTCAGGCTGCCACACTAGAGGG + Intronic
1027802019 7:82766182-82766204 GCCAAGGCTGCCACTCTCAAAGG - Intronic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1029734017 7:102455612-102455634 GCCCAGGGGTCCACTCTCGAGGG - Exonic
1031980418 7:128121113-128121135 GCCCTGACTGCCCCTCTGGCTGG + Intergenic
1034690279 7:153008327-153008349 TCCCTGGCTGCCAATTTCTAAGG - Intergenic
1037148890 8:15611218-15611240 GCCCTGTCTCCCAGTCTGGAGGG + Intronic
1043145455 8:76648232-76648254 GCCCTTGCAGCCACTCTCATGGG - Intergenic
1047337506 8:123950797-123950819 GCCCTGGCTCCCAGTCTCACGGG - Intronic
1048938191 8:139374437-139374459 GCCCTGGTTACCAGTCTCGAGGG + Intergenic
1049357168 8:142194635-142194657 GCCCTGGCTGCACCTCCGGATGG - Intergenic
1049587253 8:143437810-143437832 GCCCTGCCTGGCACCCTGGAAGG + Exonic
1049611049 8:143555487-143555509 GTCCTAGCAGCCACTCCCGAGGG - Intronic
1056858610 9:90158655-90158677 GCCGTGACTGCCTCTCTGGAAGG + Intergenic
1060929964 9:127483127-127483149 GACTTGACTGCCCCTCTCGAGGG - Intronic
1062139019 9:134945224-134945246 GCCCTCGCACCCCCTCTCGAGGG + Intergenic
1187405121 X:18996805-18996827 CCCATGGCTGCCACTCCCCAAGG + Intronic
1194073939 X:89364652-89364674 TCCCTGTCTCCCACTCTCTATGG - Intergenic
1200643092 Y:5746965-5746987 GCTCTGGTTGCCCCTCTGGAAGG - Intergenic
1200729327 Y:6716205-6716227 TCCCTGTCTCCCACTCTCTATGG - Intergenic