ID: 1132498728

View in Genome Browser
Species Human (GRCh38)
Location 16:275616-275638
Sequence CCAGGCCGCAGCTGGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132498715_1132498728 22 Left 1132498715 16:275571-275593 CCCGGATCCGGGAGCGCGGAGAT 0: 1
1: 0
2: 1
3: 6
4: 62
Right 1132498728 16:275616-275638 CCAGGCCGCAGCTGGCGGCGGGG 0: 1
1: 0
2: 0
3: 23
4: 282
1132498716_1132498728 21 Left 1132498716 16:275572-275594 CCGGATCCGGGAGCGCGGAGATT 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1132498728 16:275616-275638 CCAGGCCGCAGCTGGCGGCGGGG 0: 1
1: 0
2: 0
3: 23
4: 282
1132498717_1132498728 15 Left 1132498717 16:275578-275600 CCGGGAGCGCGGAGATTAACGCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 1132498728 16:275616-275638 CCAGGCCGCAGCTGGCGGCGGGG 0: 1
1: 0
2: 0
3: 23
4: 282
1132498714_1132498728 23 Left 1132498714 16:275570-275592 CCCCGGATCCGGGAGCGCGGAGA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1132498728 16:275616-275638 CCAGGCCGCAGCTGGCGGCGGGG 0: 1
1: 0
2: 0
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132498728 Original CRISPR CCAGGCCGCAGCTGGCGGCG GGG Intronic