ID: 1132500782

View in Genome Browser
Species Human (GRCh38)
Location 16:283720-283742
Sequence CACACGTCAGGGACCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132500782_1132500789 15 Left 1132500782 16:283720-283742 CCCATGGAGGTCCCTGACGTGTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1132500789 16:283758-283780 TCGCAACCCTTGACACACATAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132500782 Original CRISPR CACACGTCAGGGACCTCCAT GGG (reversed) Intronic