ID: 1132500782

View in Genome Browser
Species Human (GRCh38)
Location 16:283720-283742
Sequence CACACGTCAGGGACCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132500782_1132500789 15 Left 1132500782 16:283720-283742 CCCATGGAGGTCCCTGACGTGTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1132500789 16:283758-283780 TCGCAACCCTTGACACACATAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132500782 Original CRISPR CACACGTCAGGGACCTCCAT GGG (reversed) Intronic
902088025 1:13878125-13878147 CACACGACACGGACCTCCTGGGG - Intergenic
903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG + Intronic
907278457 1:53329437-53329459 CACAGGTCAGGGACCTCTCCGGG - Intergenic
907881373 1:58552038-58552060 CACGCGGCAGAGACCTCCATGGG + Intergenic
911189423 1:94933002-94933024 CCCACTTCAGGAACCTTCATGGG + Intergenic
911988719 1:104664086-104664108 CACACGGCAGGGTACTCCAATGG - Intergenic
912135525 1:106656327-106656349 CACATGTCAGAGGCCTTCATGGG - Intergenic
920226781 1:204444757-204444779 CCCACATCAGGGCCCTCCAATGG - Intronic
920540467 1:206774175-206774197 CACACAGCAGGGACATCCACAGG - Intergenic
922889204 1:229047367-229047389 CACACGGCAGGCACCAGCATTGG + Intergenic
1064991736 10:21262437-21262459 CACTCTTCAGAGACCCCCATAGG - Intergenic
1070749531 10:78955730-78955752 CAGGCGTCAGGCCCCTCCATGGG + Intergenic
1071565916 10:86671196-86671218 CACAGGACAGGGATGTCCATGGG + Intronic
1075851621 10:125592945-125592967 CACCCTCCAGGAACCTCCATGGG + Intronic
1094438407 12:30447357-30447379 CACTGGTGTGGGACCTCCATGGG + Intergenic
1104579783 12:130002753-130002775 CTCATGTCAGGTACATCCATGGG - Intergenic
1105923181 13:24983860-24983882 CACCCTCCAGGAACCTCCATGGG - Intergenic
1109475208 13:62872424-62872446 CACAAGTCTGTGACCTCTATTGG + Intergenic
1112790810 13:103000585-103000607 CACACGGCAGGCCCCTCCCTAGG - Intergenic
1123139516 14:106061727-106061749 CTCAGGGCAGAGACCTCCATGGG - Intergenic
1123144546 14:106116213-106116235 CTCAGGGCAGAGACCTCCATGGG - Intergenic
1123187834 14:106537386-106537408 CTCAGGGCAGAGACCTCCATGGG - Intergenic
1123212541 14:106774739-106774761 CTCAGGGCAGAGACCTCCATGGG - Intergenic
1125899351 15:43330550-43330572 CACACCTCACGGACCTCGGTAGG + Exonic
1130003822 15:80074121-80074143 AACAAGTCAGAGAGCTCCATAGG - Intronic
1130106473 15:80932286-80932308 CACACGTCGGGTTCCTCCAGAGG - Intronic
1131295682 15:91147310-91147332 CACATCTCAGGGAGCTCCAGAGG - Intronic
1131452874 15:92560792-92560814 CTCTCCACAGGGACCTCCATAGG - Intergenic
1132374050 15:101316788-101316810 CATACGGCAGGGAGCTGCATGGG + Intronic
1132500782 16:283720-283742 CACACGTCAGGGACCTCCATGGG - Intronic
1132748485 16:1446767-1446789 CACAAGGCAGGGAGCTCCACAGG - Intronic
1135194176 16:20380947-20380969 CCCTTGTCAGGGACCTCCTTTGG + Intronic
1136632282 16:31496001-31496023 CACACTTCTGGGACTTCCCTGGG + Intronic
1136870017 16:33798372-33798394 CTCAGGGCAGAGACCTCCATGGG + Intergenic
1137387064 16:48051514-48051536 CCCATGTCAGGGACATCCCTCGG - Intergenic
1138480247 16:57298045-57298067 CACACGTCACAGACCGCTATAGG + Intergenic
1140615974 16:76664382-76664404 CACTTGTCAGGTACCTCCACTGG - Intergenic
1141812059 16:86382493-86382515 CCCAACTCAGGAACCTCCATCGG - Intergenic
1203102153 16_KI270728v1_random:1317682-1317704 CTCAGGGCAGAGACCTCCATGGG - Intergenic
1144047437 17:11466495-11466517 CACACTTCAGGGACATCCTCAGG + Intronic
1157922876 18:51731783-51731805 CACAGGGCAGGGAGCTCCAAAGG + Intergenic
1159966963 18:74604390-74604412 CACACTTCCCAGACCTCCATAGG + Intronic
1161857532 19:6774040-6774062 CACCCGCCAGGAACCCCCATGGG - Intronic
1167042842 19:47032728-47032750 CACAGGTAAGGGACCCCCAGTGG + Exonic
948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG + Intronic
948874053 2:240818120-240818142 CTCACCACAGGGACCTCCCTGGG + Intronic
1173704637 20:45100903-45100925 CACAGGTAAGGGGCCTCCTTTGG - Exonic
1174299772 20:49572997-49573019 CACACCTCTGGGACCTCCCTTGG - Intergenic
1175177954 20:57124876-57124898 CACACATAAGGGGCCTCCACAGG + Intergenic
956196902 3:66662021-66662043 CACACTGCAGGGTTCTCCATGGG - Intergenic
968082110 3:195853825-195853847 CACAGGCCATGGACCTCCACAGG + Intergenic
968978341 4:3833559-3833581 TACAGATCAGGGAGCTCCATGGG + Intergenic
969522807 4:7688691-7688713 CCCAAGTCAGGGAACTCCATAGG - Intronic
969574711 4:8030158-8030180 CACACGTGAGAAACCCCCATAGG - Intronic
977590114 4:98816955-98816977 CACAGGTCAGGAACCTACACAGG - Intergenic
986264217 5:6179018-6179040 CACAGCTCAGGGCCCTCCCTGGG + Intergenic
991290833 5:65032429-65032451 CACACCTCAGGGATCTCCGAGGG - Intergenic
995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG + Intronic
995894326 5:116994852-116994874 CACACTTCAGGGCCTGCCATGGG + Intergenic
998010792 5:138694185-138694207 CACCCTCCAGGAACCTCCATGGG + Intronic
998036767 5:138923974-138923996 CACACCTCAGGGTCCTCTAGAGG + Intronic
1002421658 5:179152289-179152311 CCCACCTCAGGGACCTCCCAGGG + Intronic
1003922976 6:10850682-10850704 TACACCTCTGGGACCTCCATGGG - Intronic
1007175823 6:39896776-39896798 CACAGGTCAGAGGCCTGCATGGG - Intronic
1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG + Intergenic
1007616761 6:43184430-43184452 CACACTTCAGGACACTCCATCGG - Exonic
1011724480 6:90195476-90195498 CACACCTTAGGGATCTCCAGAGG - Intronic
1014624446 6:123708782-123708804 CAGATGTCAGGGACATCCACAGG + Intergenic
1018085191 6:160295239-160295261 CAGACATCATGGAGCTCCATAGG + Intergenic
1018740319 6:166723366-166723388 CACACGTGTGGGACCCCCCTGGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1023623632 7:42095990-42096012 CACCAGTCAGGGGCCTCCAAGGG + Intronic
1029449558 7:100633260-100633282 TAGACGTCAGGGTCCTCCAGCGG + Exonic
1034386209 7:150743305-150743327 CACTTCTCAGGGACCTGCATGGG - Exonic
1037456092 8:19065695-19065717 CACTCTTCAGGAACCTCCATGGG + Intronic
1043149949 8:76703372-76703394 CACACTTCAGTCACCTCAATGGG - Intronic
1052134671 9:24894975-24894997 CACACGTCAGGGCCTGTCATGGG + Intergenic
1059460417 9:114426077-114426099 CCCACACCAGGGCCCTCCATTGG - Intronic
1199851471 X:151727243-151727265 CACAGGCCAGTTACCTCCATGGG + Intergenic
1200285135 X:154813955-154813977 CACAGGTCAGGAACCTGTATAGG + Intronic