ID: 1132500924

View in Genome Browser
Species Human (GRCh38)
Location 16:284380-284402
Sequence CCCCCAGATGCCCCGTGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132500915_1132500924 15 Left 1132500915 16:284342-284364 CCTGGGGTTGTGGTGGCCTGGGG 0: 1
1: 0
2: 3
3: 60
4: 710
Right 1132500924 16:284380-284402 CCCCCAGATGCCCCGTGGTGTGG 0: 1
1: 0
2: 2
3: 20
4: 145
1132500918_1132500924 -1 Left 1132500918 16:284358-284380 CCTGGGGCACTCACGGCCCCATC 0: 1
1: 0
2: 1
3: 23
4: 185
Right 1132500924 16:284380-284402 CCCCCAGATGCCCCGTGGTGTGG 0: 1
1: 0
2: 2
3: 20
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132500924 Original CRISPR CCCCCAGATGCCCCGTGGTG TGG Exonic
900522121 1:3110894-3110916 CCGCCTGATGCCCCGGGGTGGGG + Intronic
900555339 1:3277458-3277480 CACCCAGAGACCCTGTGGTGAGG - Intronic
901512477 1:9724439-9724461 CCACCAGATGCCCCTCGGTGTGG + Intronic
903333383 1:22608936-22608958 TCCCCAGCTGCCCAGTGCTGGGG - Intergenic
908186229 1:61655360-61655382 CACACAGATGCCCCTTGCTGAGG + Intergenic
908564398 1:65339810-65339832 GCCCCAGAAGCCCAGGGGTGAGG - Intronic
920102529 1:203526282-203526304 CCCCCAGATGCCCCTTGGCTTGG - Intergenic
921286676 1:213615673-213615695 CCCCCAGATGGCGCGTTCTGTGG - Intergenic
922606701 1:226894143-226894165 CGTCCAGCTGCCTCGTGGTGGGG + Intronic
924248393 1:242107073-242107095 CGCCCAGATGCCTCGTCGTCTGG - Intronic
1063918581 10:10909257-10909279 CCCCCAGATACCCTGAAGTGAGG - Intergenic
1065173434 10:23054244-23054266 CCCCCAGATGCACCATGCTCTGG + Intergenic
1065679557 10:28214899-28214921 CCCCCAGGAGCCACGTGGAGAGG - Intronic
1069773446 10:70913578-70913600 CCCCCACCTGCCCTGTGGAGAGG - Intergenic
1072805616 10:98422446-98422468 CCACCATCTGCCCAGTGGTGCGG + Exonic
1075337432 10:121618275-121618297 TCCCCAGATGCCCCTTGCTGTGG - Intergenic
1076133434 10:128028998-128029020 GCCCCACATGCCCCGTCCTGTGG + Intronic
1077431963 11:2520206-2520228 CCCCCAGAAGCCCCCTGGATTGG - Intronic
1077478876 11:2803670-2803692 CCCCCAAATGCCCAGGGCTGTGG + Intronic
1081582433 11:44361342-44361364 CTCCCAGCGGCCCCGTAGTGGGG + Intergenic
1083223354 11:61267816-61267838 CCACCTGATCCCCCCTGGTGAGG - Intronic
1084400501 11:68940266-68940288 CTCACAGGAGCCCCGTGGTGAGG - Exonic
1084460356 11:69293575-69293597 CCCCCAGCTGCCCAGCTGTGAGG + Intergenic
1088048746 11:105484691-105484713 ACACCAGATGCCTCTTGGTGTGG + Intergenic
1094316941 12:29145597-29145619 CCCCCCCATGCCCCCTGCTGGGG - Intergenic
1094845590 12:34360045-34360067 CCCACAGATGCTACGTGGGGAGG + Intergenic
1094845778 12:34360789-34360811 CCCACAAATGCACCGTGGGGAGG + Intergenic
1094856101 12:34403529-34403551 CCCACACATGCACCGTGGGGAGG - Intergenic
1096773366 12:53950208-53950230 CCCCCACCTGCCTCCTGGTGGGG + Intergenic
1097187077 12:57201778-57201800 AGCCCAGATGACCTGTGGTGTGG + Exonic
1102842552 12:116141646-116141668 CCACCAGAGTCCCTGTGGTGAGG - Intronic
1103972131 12:124678906-124678928 CCCCCAGATGACCCCAGGGGAGG - Intergenic
1104601423 12:130156414-130156436 CCCCCAGTAGCCCCGTGGCCTGG + Intergenic
1104991289 12:132625208-132625230 ACCCCAGATGCCCAGTCCTGAGG + Intronic
1105006028 12:132721124-132721146 CCCACAGCTGACCCGTGCTGAGG + Exonic
1105788252 13:23770609-23770631 CCCCCAGGTGCTCTCTGGTGTGG + Intronic
1112857440 13:103788225-103788247 GCCCCAGAGGCCACCTGGTGGGG - Intergenic
1113842216 13:113366553-113366575 CCCACAGAGGCCCCCTGGTGTGG - Intergenic
1113900421 13:113793832-113793854 CCCCCAGCGGGCCTGTGGTGTGG + Intronic
1113981771 13:114282047-114282069 CCTCCAGCTGCTCCTTGGTGAGG - Exonic
1116458554 14:45145578-45145600 CCCCCAGAGGCCCTGTGGTGTGG - Intronic
1117270327 14:54136901-54136923 CCCCCAGTGGCCTGGTGGTGGGG - Intergenic
1118773917 14:68961722-68961744 TCCCCAGATGCCCAGTTGTGAGG - Intronic
1119260910 14:73237643-73237665 CCTGCAGAAGCCCCGGGGTGCGG - Intronic
1121525058 14:94613899-94613921 CCTCTAGATGTCACGTGGTGTGG - Exonic
1121559608 14:94864791-94864813 TCCCCAAAGGCCACGTGGTGGGG + Intergenic
1121940635 14:98067346-98067368 CCCGCAGATACCTTGTGGTGTGG - Intergenic
1122266626 14:100549758-100549780 CCCCCAGATTCCCAGTGGCCTGG - Intronic
1124995878 15:34722416-34722438 CCCCCAGTTCCACCGTGGAGTGG - Intergenic
1126112248 15:45182175-45182197 CCCTCTGGAGCCCCGTGGTGGGG - Intronic
1127612610 15:60651650-60651672 CTCCCAGAAGCCCCCTGGAGTGG - Intronic
1128349879 15:66881612-66881634 CTCTCAGATGCCCCAAGGTGAGG - Intergenic
1128528160 15:68426406-68426428 CCCCCAGGTGCCCAGTGCTCTGG - Intronic
1129118355 15:73379301-73379323 CTCCCAGATGCTCCTTGGTTTGG + Intergenic
1131831813 15:96359496-96359518 CCCCAAGACTCCCCGAGGTGGGG + Intergenic
1132500924 16:284380-284402 CCCCCAGATGCCCCGTGGTGTGG + Exonic
1132522312 16:397411-397433 CCCCCAGAGGCCTCGGGGCGCGG + Intronic
1132672432 16:1107326-1107348 CCTCCAGGTGCCCTGGGGTGCGG + Intergenic
1132973632 16:2701005-2701027 CTCCCAGTTGTCCCTTGGTGGGG + Intronic
1133209692 16:4256722-4256744 CCCCCTGCCCCCCCGTGGTGTGG - Intergenic
1133513568 16:6483968-6483990 GCCCTGGGTGCCCCGTGGTGGGG + Intronic
1139429606 16:66904117-66904139 CCTCCAGATTCCCCCTGCTGAGG - Intergenic
1141440389 16:84026063-84026085 ACGGCAGATGCCCCGAGGTGGGG + Intronic
1141919764 16:87127910-87127932 CTCGCAGCTGCCCAGTGGTGGGG - Intronic
1142119847 16:88381893-88381915 CCACCAGAAGGCCCGTGGTTAGG + Intergenic
1144613490 17:16746712-16746734 CCTCCAGCTGCTCCTTGGTGAGG + Intronic
1145133161 17:20376788-20376810 CCTCCAGCTGCTCCTTGGTGAGG + Intergenic
1146696013 17:34909596-34909618 CCCACAGAGGGCCCTTGGTGGGG + Intergenic
1148863198 17:50615204-50615226 CCCCACGCTGCCCCTTGGTGGGG - Intronic
1149597090 17:57870646-57870668 CCCCAAAATGCCCCGTGGTGGGG - Intronic
1149660613 17:58332408-58332430 CCCCTAGAGGCCCCGAGCTGAGG + Intergenic
1151323794 17:73366740-73366762 CTCCCAGAAGCCCCGTGGACAGG - Intronic
1152245395 17:79182587-79182609 CCCCAGGATGCCCCGTGGGGAGG - Intronic
1152285741 17:79411619-79411641 CCCCCACCTGCACAGTGGTGAGG + Intronic
1152517997 17:80837332-80837354 CCCCCTGCTGCTCCCTGGTGTGG - Intronic
1152579356 17:81159305-81159327 CTCCCAGCTGCCCCATGTTGGGG - Intronic
1152708677 17:81859372-81859394 CTTCCAGATGCCCCTTGGTGTGG - Exonic
1155179269 18:23330028-23330050 CCCCGACAGGCCCCGTTGTGTGG - Intronic
1157197535 18:45631525-45631547 TTCCCAGGTGCCCCTTGGTGAGG - Intronic
1159946120 18:74446003-74446025 GCCCCACGTGCCCCGTGGTGCGG + Intronic
1160223994 18:76998299-76998321 CCTCCAGGCGCCCCGTGCTGCGG + Intronic
1160491361 18:79338598-79338620 CCCCCAGATGCTGTGTGGCGGGG + Intronic
1160760771 19:783025-783047 CCCCCAAATCCCCTTTGGTGAGG - Intergenic
1161315470 19:3615329-3615351 CGCCGGGATGCCACGTGGTGTGG - Intronic
1161399844 19:4062365-4062387 CCCCCAGCTGCTCCGAGGAGCGG - Intronic
1162502111 19:11059969-11059991 CTCCCAGACGCCCCTTGCTGTGG + Intronic
1162566049 19:11446354-11446376 CCCCCGGCTGCCCCTTGGTTGGG + Intronic
1163026875 19:14517862-14517884 CCCCGAGCAGCCCCGGGGTGCGG - Intronic
1163038092 19:14583265-14583287 GCCTCAGCTGCCCCATGGTGGGG - Intronic
1163640249 19:18458010-18458032 CCCCAGGGTGTCCCGTGGTGGGG - Intronic
1165145109 19:33725657-33725679 CCCCCAGAGTCCCAGTGGTGAGG - Intronic
1165937328 19:39397380-39397402 CCCCCAGCTGGCCCTTGGGGTGG + Intronic
1166326885 19:42056537-42056559 CTCCCTGAGGCCTCGTGGTGTGG - Intronic
1166976694 19:46609042-46609064 CCCCCAGATCCCTCTTGTTGGGG + Intronic
1167311292 19:48739344-48739366 CCCCCGGAGGCGCCGTGGCGCGG + Exonic
926229566 2:10992408-10992430 CCCCCAGATGCCCTGTGTAGAGG + Intergenic
927697464 2:25247822-25247844 CCCCCAGATGCCCAGGGCTGGGG - Intronic
932125793 2:69144547-69144569 TCCCCAGGTGCCCCGTGGAGGGG + Intronic
933388731 2:81644473-81644495 CCCCCAAACGTCCCCTGGTGTGG - Intergenic
934525795 2:95050773-95050795 CCCCCAGGGGTCCCGCGGTGTGG + Intronic
936165620 2:110116840-110116862 CCCCCTGCTGCTCCCTGGTGTGG + Intergenic
942116660 2:172735572-172735594 GCCTCAGAGGCCCCGGGGTGAGG + Intronic
944510181 2:200456738-200456760 TCCTCAGATGCCCAGTGGAGGGG - Intronic
948455431 2:238102434-238102456 TCCCGAGATGCCCCCAGGTGGGG - Intronic
948471401 2:238182928-238182950 CCCCCAGAAGCATCGTGGGGAGG + Intronic
948530313 2:238599877-238599899 CCCCCACATGCCTCCTGCTGGGG + Intergenic
1168997491 20:2144216-2144238 CCCCCAGATTCCCTATGGGGAGG - Exonic
1172645254 20:36465172-36465194 CCCCCGCATGCCCTGTGGTTGGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174409967 20:50328860-50328882 CCCTCAGATGCCCCTCAGTGGGG - Intergenic
1174579854 20:51563722-51563744 CCCCCAGAAGGTCCGTGGGGAGG + Intergenic
1175126068 20:56752349-56752371 CCCCAAGAATCCCCATGGTGGGG - Intergenic
1176042492 20:63072733-63072755 CCCCCAGGTCCTCCGTGGAGCGG - Intergenic
1176060009 20:63168402-63168424 CCCCAAGATGGACCATGGTGAGG + Intergenic
1179596972 21:42449461-42449483 CACCCAGGTGCCCAGCGGTGGGG - Intergenic
1179988837 21:44935337-44935359 CCCACAGATGCCCCATGCTGGGG - Intronic
1180972387 22:19822329-19822351 CCCCCACAGGCCCAGTGGTCTGG - Intronic
1181437476 22:22919033-22919055 CCCACAGAGGCCCCTTGGTGGGG - Intergenic
1181602461 22:23960544-23960566 CCCCCAGCTGCCCCGGAATGTGG - Intronic
1181606052 22:23980763-23980785 CCCCCAGCTGCCCCGGAATGTGG + Intronic
1181633654 22:24164389-24164411 CCGCCAGATGCCCTGTGGGATGG - Exonic
1181732165 22:24855267-24855289 CCCCCACATGCCCCTCAGTGGGG + Exonic
1184138510 22:42563537-42563559 GCCCCTGAAGCCCCGTGCTGTGG + Intronic
1184800316 22:46754928-46754950 TCACCAGATGCCCAGCGGTGGGG - Intergenic
1185021783 22:48380653-48380675 GCCCCAGATGCCCAGGGGTGTGG + Intergenic
1185066475 22:48634889-48634911 CTCCCAGATGCCCCATGGGCTGG - Intronic
1185333848 22:50262918-50262940 CCCCCTTACTCCCCGTGGTGGGG + Intergenic
950992069 3:17449761-17449783 CCCCCAGGTGCTCCGTCCTGGGG - Intronic
952327272 3:32332690-32332712 CCCCCAGAGGCCCCATCGAGTGG - Intronic
957475859 3:80722867-80722889 CACCCAGAACCCCCTTGGTGTGG + Intergenic
962299117 3:134221951-134221973 CCCCCATGTGTCCTGTGGTGAGG - Intronic
967521254 3:190435507-190435529 CCCTCTGATGCCCCCTGTTGTGG - Intronic
967892241 3:194371679-194371701 CCTCCAAATGTCACGTGGTGAGG - Intergenic
968947512 4:3673205-3673227 CCCCCAGATCCCCTGTGGGATGG - Intergenic
974056213 4:56985419-56985441 CCCCCCGCCGCCCCGTGGGGCGG + Intronic
997378891 5:133421162-133421184 CCCTGAGATGCCTGGTGGTGTGG - Intronic
998133272 5:139661728-139661750 CCCCTAGACGCCCCGTGTTTAGG + Intronic
998403832 5:141862701-141862723 GCCCCAGAAGCCTAGTGGTGAGG + Intronic
999750907 5:154627654-154627676 CCCCCAGAGGCACCTGGGTGGGG - Intergenic
999751128 5:154628906-154628928 CTCCCAGATGCCCAGTGGGATGG + Intergenic
1000164478 5:158634699-158634721 CACCCAGATGGCCCATGGAGAGG - Intergenic
1001889414 5:175326774-175326796 CCCCCAGAACCCTCATGGTGGGG + Intergenic
1002521805 5:179796440-179796462 CCTCCAGCTGCCCCGGGGAGGGG + Exonic
1002874927 6:1202300-1202322 GCCCCTGAAGCCCTGTGGTGAGG + Intergenic
1005843126 6:29757610-29757632 GCCACAGATGCCCTGTGTTGAGG - Intergenic
1007165218 6:39824295-39824317 CCCCAAGATGCCCCCTGCTGGGG - Intronic
1019931491 7:4226247-4226269 CTCCCAGATACCCAGCGGTGAGG - Intronic
1020276419 7:6627382-6627404 CCACCAGGTGCCCCGTGGGGAGG - Intergenic
1022873784 7:34506832-34506854 CCCACAGCTGACGCGTGGTGGGG + Intergenic
1024766713 7:52668841-52668863 GCCCCAGGTGCCACGTGTTGAGG + Intergenic
1026404196 7:70048087-70048109 CCCCCAGAAGCACAGTGGAGAGG - Intronic
1028528849 7:91816106-91816128 CCAACAGATGCCACATGGTGTGG - Intronic
1032790376 7:135238230-135238252 CCCCCAGGCGCCCCCTGGTCAGG - Intronic
1034999151 7:155597596-155597618 CCCCCAGCTGCTCAGTGCTGAGG - Intergenic
1037751836 8:21687307-21687329 CCCCGAGATGCTACGGGGTGTGG - Intergenic
1037787050 8:21909451-21909473 CCCGCAGGAGCCCCGGGGTGAGG - Exonic
1047522920 8:125609277-125609299 CCCCCAGATCCCCCTTGCTGAGG - Intergenic
1049002752 8:139836568-139836590 CCCTCAGTTGCCCCGTGTGGCGG - Intronic
1049022197 8:139965093-139965115 CCCCCAGAGACCCCCTGCTGAGG - Intronic
1049429199 8:142551338-142551360 CCCACAGCAGCCCCGGGGTGGGG - Intergenic
1056055081 9:82813546-82813568 CTCCCAGCTCCCCCGAGGTGAGG + Intergenic
1056801492 9:89695152-89695174 CTCCCAGATGCCCCGGTGTGAGG - Intergenic
1057031098 9:91775687-91775709 CCTCCAAATGCCCTGTGCTGAGG - Intronic
1059277820 9:113110253-113110275 CCCCTAGATACCCAGTGGGGAGG + Intergenic
1059278431 9:113114298-113114320 CCCCTAGATACCCAGTGGGGAGG - Intergenic
1060147946 9:121268237-121268259 CCCCCAGATGCCCGGGGCCGGGG - Intronic
1189989105 X:46577901-46577923 CCCTGAGATGCCCTGTGGGGAGG - Intronic
1199399128 X:147376513-147376535 GCCACAGATGCCCTGTGGAGAGG - Intergenic