ID: 1132501858

View in Genome Browser
Species Human (GRCh38)
Location 16:288015-288037
Sequence AGCCCGATGGGGAACAGTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132501858_1132501862 -10 Left 1132501858 16:288015-288037 CCAACACTGTTCCCCATCGGGCT 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1132501862 16:288028-288050 CCATCGGGCTCCTGAGTACGAGG 0: 1
1: 0
2: 0
3: 6
4: 374
1132501858_1132501867 26 Left 1132501858 16:288015-288037 CCAACACTGTTCCCCATCGGGCT 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1132501867 16:288064-288086 CGTGACACCCGTGCCCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 45
1132501858_1132501864 2 Left 1132501858 16:288015-288037 CCAACACTGTTCCCCATCGGGCT 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1132501864 16:288040-288062 TGAGTACGAGGTCATCTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1132501858_1132501868 27 Left 1132501858 16:288015-288037 CCAACACTGTTCCCCATCGGGCT 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1132501868 16:288065-288087 GTGACACCCGTGCCCGCCAAGGG 0: 1
1: 0
2: 2
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132501858 Original CRISPR AGCCCGATGGGGAACAGTGT TGG (reversed) Exonic
900258078 1:1707446-1707468 AGCTCGATGGGCAACAGGGCAGG + Exonic
900469537 1:2846830-2846852 AGCCCGATGGCTCACACTGTGGG + Intergenic
901013272 1:6212834-6212856 AGCGCTAAGGGGAAGAGTGTGGG - Intronic
901246826 1:7738312-7738334 AATCCGAAGGGGACCAGTGTAGG + Exonic
902488194 1:16761771-16761793 AGGCAGATGGGGATCAGGGTTGG + Intronic
903183572 1:21617519-21617541 CGCCCAGTGGGGTACAGTGTGGG - Intronic
904288926 1:29471318-29471340 AGGCTGATGGGGAAGAGTTTGGG + Intergenic
904929147 1:34072755-34072777 AGCCAGGTGGGCAGCAGTGTCGG - Intronic
908387815 1:63659141-63659163 AGTCCCATTGGGAACAGTGTGGG + Intronic
916063868 1:161120606-161120628 AGACCCCTGGGGAACAGTGGTGG + Exonic
917588461 1:176452476-176452498 AGGCAGAGAGGGAACAGTGTTGG + Intergenic
918852402 1:189708934-189708956 CGCCCGGTGGGGAAGACTGTGGG - Intergenic
920251307 1:204624216-204624238 ACCCCCCTGGGGGACAGTGTGGG + Intronic
923018937 1:230148108-230148130 AGCGGGATGGGGAAGAGTGTGGG - Intronic
923613358 1:235514976-235514998 AGCCTGCTGGGCAACAGAGTGGG + Intergenic
1068568989 10:58607591-58607613 AGGCCGATGGGGAAGAGTGAGGG - Intronic
1074111995 10:110429312-110429334 AGGGAGATGGGAAACAGTGTTGG - Intergenic
1076768274 10:132649527-132649549 AGCCACATGGGGATCAGTGTGGG + Intronic
1077281412 11:1747881-1747903 GACTCCATGGGGAACAGTGTGGG + Exonic
1077553948 11:3217205-3217227 GGCCGGGTGGGGACCAGTGTGGG + Intergenic
1088844476 11:113653189-113653211 AGACTGAAAGGGAACAGTGTGGG - Intergenic
1093505230 12:19857600-19857622 AGAGCAATAGGGAACAGTGTTGG - Intergenic
1104453391 12:128889673-128889695 AGTCCGCTGGGGGACAGTGCGGG - Intronic
1112644826 13:101318247-101318269 AGCCAGGTGGGGAGCAGTGCGGG + Intronic
1113905632 13:113817997-113818019 AGCCGGCTGGGGAACATTATGGG + Intergenic
1114551389 14:23534637-23534659 GGCCCCATGGGGAACAGCGGGGG - Exonic
1118663763 14:68044010-68044032 AGCCTGATGGGCAATAATGTTGG - Intronic
1120498238 14:85262337-85262359 AGGATGATGGGGAACAGGGTAGG + Intergenic
1120760140 14:88277501-88277523 AGCCCCATGAGGAATAATGTGGG - Intronic
1123627696 15:22238951-22238973 AGGCCGGAGTGGAACAGTGTTGG - Intergenic
1132501858 16:288015-288037 AGCCCGATGGGGAACAGTGTTGG - Exonic
1135918182 16:26624731-26624753 ATCCCAATGGGGAACAGTCAAGG - Intergenic
1138169379 16:54834542-54834564 AGCCACATGGAAAACAGTGTGGG + Intergenic
1139367324 16:66441543-66441565 AGCCCAAATGGGAACAGGGTGGG - Intronic
1143857466 17:9862832-9862854 AACCCCTTGGGGAACAGGGTGGG - Intronic
1145756039 17:27390642-27390664 AGCCAGATGGGGACCATGGTGGG - Intergenic
1152770068 17:82162377-82162399 AGCCCCATGGGAAACAGGGTGGG + Intronic
1160439413 18:78877762-78877784 AGCCCGCTGAGGAACACTGATGG + Intergenic
1161522043 19:4730107-4730129 AGCCCGCTGGGGAGGGGTGTGGG - Intergenic
1161960015 19:7518017-7518039 CCCCACATGGGGAACAGTGTGGG - Intronic
1164408761 19:27978897-27978919 ACCCCTATGGAGAACAGTTTGGG + Intergenic
1164715101 19:30385292-30385314 GACCCGATGGGGGTCAGTGTGGG + Intronic
1165023158 19:32940247-32940269 AGCGTGATGGGGAGGAGTGTTGG - Intronic
1165023187 19:32940365-32940387 AGCGTGATGGGGAGGAGTGTTGG - Intronic
1165023200 19:32940424-32940446 AGCGTGATGGGGAGGAGTGTTGG - Intronic
1166552242 19:43673771-43673793 AGCCCAATGGTTAAGAGTGTGGG + Intergenic
1167374072 19:49101929-49101951 TGCCCGCTGAGGAACAGGGTGGG - Intronic
1202703003 1_KI270713v1_random:2469-2491 AGGCAGATGGGGATCAGGGTTGG - Intergenic
926082975 2:10003864-10003886 AGCCCGAGGGGGGACACTGAAGG - Intergenic
930658392 2:54029750-54029772 AGCATGCTGGGGAACATTGTAGG + Intronic
937310146 2:120897064-120897086 AGCCCCATGGGGAACAGTGCAGG - Intronic
938318109 2:130343835-130343857 AGCTCCGTGGGGAACAGTGCTGG + Intronic
941395549 2:164968810-164968832 AGCCCGATCGGGAGCAGCATTGG + Intergenic
946039786 2:216773745-216773767 CGCCAGATGGAGAACAGTGCTGG - Intergenic
946216231 2:218185909-218185931 ATGCAGATGGGGGACAGTGTGGG - Intergenic
948155094 2:235775115-235775137 AGCCAGCTGGGGAACAGAGAAGG + Intronic
948181969 2:235989428-235989450 AGCTCGATGGTGATGAGTGTAGG + Intronic
948575744 2:238948335-238948357 AGTCCATTGGGAAACAGTGTGGG - Intergenic
1177842106 21:26246104-26246126 AGCCAGATGTGGAACAGCCTGGG - Intergenic
1178511318 21:33207249-33207271 GAACCGATGGGGAAGAGTGTTGG - Intergenic
1185372992 22:50469479-50469501 AGCCCGGTGGGGACCACAGTGGG + Intronic
949573669 3:5318257-5318279 AGAAGGATGGGGAACACTGTGGG + Intergenic
953634476 3:44651100-44651122 AGCCCCATGGGGCCCAGTGAAGG + Exonic
954298821 3:49688565-49688587 AGGCAGATGGGGATCAGGGTTGG + Intronic
954794977 3:53156827-53156849 TGGCCCATGGGAAACAGTGTAGG - Intronic
955826329 3:62951576-62951598 ACCCCGGTGGGGACCTGTGTTGG - Intergenic
958606550 3:96364929-96364951 AGCCCCATGGAGACCAGTTTTGG - Intergenic
960967553 3:123115679-123115701 AGGCTGATGGTGAACAGTGCTGG - Intronic
965496437 3:169404552-169404574 ATCCCCATAGGCAACAGTGTGGG - Intronic
968733713 4:2284420-2284442 AGCGCGACGGGGCACAGTGGTGG + Intronic
971482767 4:27128829-27128851 AGCCAGAGGGGTATCAGTGTAGG - Intergenic
974474298 4:62360341-62360363 AGCCAGATGGAGAATAGTTTAGG - Intergenic
977225164 4:94385866-94385888 AGCCTGATGGGTGACAGGGTCGG + Intergenic
986492296 5:8305979-8306001 AGCCCTAAGCGGTACAGTGTGGG - Intergenic
1004800691 6:19143884-19143906 AGCGTGCTGGGGAACATTGTAGG - Intergenic
1004931349 6:20466019-20466041 ACCCCTATGGAAAACAGTGTGGG - Intronic
1005265524 6:24108448-24108470 AGCCGGATGGAGAAAAGTGGTGG - Intergenic
1007209672 6:40182726-40182748 AGTCAAATGGGGAAGAGTGTGGG + Intergenic
1012949633 6:105504312-105504334 GGCCCTTTGGGGAACAATGTTGG + Intergenic
1015514593 6:134071561-134071583 GGCCCCATGGGGAACACGGTTGG - Intergenic
1017608512 6:156158708-156158730 AGGCTGATTGGGAATAGTGTTGG + Intergenic
1027532872 7:79357229-79357251 AGCCTGATGAGGTACAGTGTTGG - Intronic
1027712611 7:81624601-81624623 TTCCAGATGGGGAACAGAGTAGG - Intergenic
1029253656 7:99254339-99254361 AGCCAGATGAGGACCACTGTGGG + Intergenic
1029457188 7:100677332-100677354 AGCCTGGTGGGGAACGGTGTAGG - Exonic
1031085659 7:117299267-117299289 AGCCACATGGGGAAGAGTGGTGG - Intronic
1032487071 7:132296075-132296097 AGCCCAGTGGAGACCAGTGTCGG + Intronic
1033306751 7:140230858-140230880 AGCCCGATGGGGAAGGGCGGCGG + Intergenic
1033333804 7:140435639-140435661 AGCCAGATGGGGCACAGCGGCGG - Intergenic
1033346238 7:140527364-140527386 AGCCCGATGAGGAAGGGCGTCGG + Exonic
1039432187 8:37533577-37533599 AGCCCGAAGGGGAAAAGGATGGG - Intergenic
1040888671 8:52292606-52292628 TGTCCTATGGGGAACAGTCTTGG + Intronic
1040995038 8:53392527-53392549 ATTCTGATGGGGAACAGTATTGG + Intergenic
1046439216 8:114236622-114236644 AGCCAGAAGGGGAACGGAGTGGG - Intergenic
1049594394 8:143476795-143476817 AGGGCCATGGGGACCAGTGTGGG - Intronic
1054912339 9:70465968-70465990 AGCCAGAAGGGGGACAGAGTGGG + Intergenic
1056659682 9:88534909-88534931 AGCGCAGTGGGGGACAGTGTGGG + Intergenic
1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG + Intronic
1061734039 9:132640200-132640222 AGCCCCATGGGGAAGAATGGGGG + Intronic
1062307809 9:135919624-135919646 GGGCCAATGGGGAACAGAGTGGG - Intergenic
1186510095 X:10124352-10124374 AGCCCCAGGGGAAACAGGGTAGG - Intronic
1191201641 X:57789219-57789241 ACCCCTATGGAGAACAGTTTGGG + Intergenic
1192736274 X:73852180-73852202 ACCCCGATGGGCCAGAGTGTTGG + Intergenic
1195708020 X:107752188-107752210 AAACAGATGGTGAACAGTGTAGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic