ID: 1132502471

View in Genome Browser
Species Human (GRCh38)
Location 16:290611-290633
Sequence CTTTATGTGCTCAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132502471_1132502479 11 Left 1132502471 16:290611-290633 CCTGCCACCTTGAGCACATAAAG 0: 1
1: 0
2: 1
3: 8
4: 296
Right 1132502479 16:290645-290667 ACGGCCCATGTGGGATCACATGG 0: 1
1: 0
2: 0
3: 6
4: 74
1132502471_1132502477 2 Left 1132502471 16:290611-290633 CCTGCCACCTTGAGCACATAAAG 0: 1
1: 0
2: 1
3: 8
4: 296
Right 1132502477 16:290636-290658 GCCGTCGACACGGCCCATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1132502471_1132502482 30 Left 1132502471 16:290611-290633 CCTGCCACCTTGAGCACATAAAG 0: 1
1: 0
2: 1
3: 8
4: 296
Right 1132502482 16:290664-290686 ATGGTCTGAGCCCTTTCTCACGG 0: 1
1: 0
2: 0
3: 16
4: 158
1132502471_1132502475 -8 Left 1132502471 16:290611-290633 CCTGCCACCTTGAGCACATAAAG 0: 1
1: 0
2: 1
3: 8
4: 296
Right 1132502475 16:290626-290648 ACATAAAGGCGCCGTCGACACGG 0: 1
1: 0
2: 0
3: 0
4: 17
1132502471_1132502476 1 Left 1132502471 16:290611-290633 CCTGCCACCTTGAGCACATAAAG 0: 1
1: 0
2: 1
3: 8
4: 296
Right 1132502476 16:290635-290657 CGCCGTCGACACGGCCCATGTGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132502471 Original CRISPR CTTTATGTGCTCAAGGTGGC AGG (reversed) Intronic
901892222 1:12276511-12276533 ATTTCTGTGCTCAAGGTGTTTGG + Exonic
902007691 1:13245448-13245470 CTTTAGGAGCCCAAGGTGGGCGG - Intergenic
902317103 1:15629973-15629995 CTTTGGGAGGTCAAGGTGGCTGG - Intronic
902662616 1:17915679-17915701 CTACATGTGCCCAAGGTGGTAGG - Intergenic
903392581 1:22975044-22975066 GATTATGTGCCCAAGGTGGTTGG - Intergenic
903405669 1:23093230-23093252 CTTTATCTCCTCCAGTTGGCTGG + Exonic
905875370 1:41428687-41428709 CCTTCTGTTCTCATGGTGGCTGG - Intergenic
906393839 1:45443144-45443166 CTTTGTGTGGCCAAGGTGGGGGG + Intronic
906414787 1:45612608-45612630 CTGTATGTGCTAGAGCTGGCTGG + Intronic
906418116 1:45638694-45638716 CTTTGTGAGGTCAAGGTGGGAGG + Intronic
906599495 1:47112674-47112696 CTTTGTGAGGTCAAGGTGGGAGG + Intronic
906619987 1:47268509-47268531 CTTTAGGAGGTCAAGGTGGGTGG + Intronic
906732344 1:48093852-48093874 TTCTATGTGCACCAGGTGGCAGG + Intergenic
907647910 1:56262705-56262727 ATTCATGTGCCCAAGGTAGCAGG - Intergenic
916273754 1:162971648-162971670 ATTTAAGTGCACAAGGTGGGTGG + Intergenic
916684768 1:167134547-167134569 CCTCATGTGGCCAAGGTGGCTGG + Intergenic
918367109 1:183820028-183820050 CTTTAGGGGCCCAAGGTGGGAGG - Intronic
919281171 1:195490866-195490888 CTTTATGCCTTCATGGTGGCTGG + Intergenic
919448289 1:197737871-197737893 CTTTATTTCCTCAAGGTGATTGG - Intronic
919815406 1:201435027-201435049 CTTTGTGTGGTCAAGGTGGGAGG - Intergenic
923140326 1:231156432-231156454 CTTTAGGAGGTCAAGGTGGGAGG + Intergenic
1062773631 10:126171-126193 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1063953817 10:11247619-11247641 CTTCAGGTGCTCAGTGTGGCAGG - Intronic
1064932288 10:20641007-20641029 CTTGATGTTCTCAAGGTAGATGG + Intergenic
1065655178 10:27941238-27941260 CTTTAGGAGCTCGAGGTGGGAGG + Intronic
1066060941 10:31723034-31723056 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1066329165 10:34399329-34399351 CTTTCAGTGCTCGAGGCGGCAGG - Exonic
1066419714 10:35253519-35253541 CTTTAGGAGGTCAAGGTGGGAGG - Intronic
1066472133 10:35709432-35709454 CTGTATGTTCTCAGGGTGGGAGG - Intergenic
1067670945 10:48320478-48320500 CTTTGGGAGCTCAAGGTGGGAGG - Intronic
1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG + Intergenic
1068743350 10:60500449-60500471 CTTTTTGTGCACAAGGTACCTGG - Intronic
1069127020 10:64648626-64648648 CTTTGTGTGTTCAAGGAGACAGG + Intergenic
1070029943 10:72667215-72667237 CTTTAGGAGGTCAAGGTGGGTGG - Intergenic
1070477182 10:76841009-76841031 CCAGATGTGCACAAGGTGGCAGG - Intergenic
1070624502 10:78041081-78041103 CTTTATGTGGCCAAGGTAGGAGG - Intronic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1073600467 10:104841485-104841507 CATTATGTGCCAAAGGTGACGGG - Intronic
1074692855 10:116022355-116022377 CTTTGTATCCTAAAGGTGGCAGG - Intergenic
1076652703 10:132000826-132000848 CAGCATGTGCCCAAGGTGGCCGG - Intergenic
1077404788 11:2378047-2378069 CTTGATGAGCTCATGGGGGCGGG - Intronic
1078061861 11:8052716-8052738 CTTTGTGAGGCCAAGGTGGCCGG - Intronic
1085685339 11:78616691-78616713 CTTTGTGGGGTCAAGGTGGGAGG - Intergenic
1087256687 11:95963963-95963985 CAATATGTGCCAAAGGTGGCTGG + Intergenic
1087897357 11:103601440-103601462 ATTGATGTCCTCTAGGTGGCAGG - Intergenic
1088597377 11:111450424-111450446 CTCTATGTGGTCAAGATGGATGG + Intronic
1089827862 11:121295218-121295240 CAATATGTGCCCAAGGTGGTCGG + Intronic
1091574554 12:1721123-1721145 CAACATGTGCTCAAGGTGGCCGG - Intronic
1091598268 12:1895880-1895902 CTTTAGGAGATCAAGGTGGGAGG - Intronic
1092755884 12:11762945-11762967 TTTTATGTCCTCAAGAGGGCTGG - Intronic
1095133927 12:38574970-38574992 CTTTGGGAGGTCAAGGTGGCTGG + Intergenic
1096131827 12:49165425-49165447 CTTTGTGAGGTCAAGGTGGTAGG - Intergenic
1096187774 12:49593727-49593749 CTTTGGGAGGTCAAGGTGGCAGG + Intronic
1097065549 12:56317931-56317953 CTTTGTGAGCCCAAGGTGGGTGG + Intronic
1097729324 12:63109619-63109641 CTTTGTGGGGTCAAGGTGGGTGG - Intergenic
1098305924 12:69102619-69102641 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1099516705 12:83605805-83605827 CTTTAGGAGGTCAAGGTGGGTGG + Intergenic
1099545174 12:83970362-83970384 GGATATGTGCCCAAGGTGGCTGG + Intergenic
1100945489 12:99778262-99778284 CTTTAAGAGGCCAAGGTGGCTGG + Intronic
1102671631 12:114624261-114624283 CTTTAGGAGGTCAAGGTGGGTGG + Intergenic
1102892729 12:116573165-116573187 CTTTAAGAGGTCAAGGTGGGAGG - Intergenic
1103306898 12:119972317-119972339 CTTTAGGAGCTCAAGGTGGGCGG + Intergenic
1103363997 12:120369290-120369312 CTTTATGCGCGCAGGGCGGCGGG - Intergenic
1103502133 12:121411169-121411191 CTTTAGGTGGCCAAGGTGGGAGG - Intronic
1104527834 12:129540731-129540753 CTTTAGGAGGCCAAGGTGGCAGG - Intronic
1106531693 13:30599223-30599245 CTTTATGAGGCCAAGGTGGGCGG + Intronic
1106768289 13:32937927-32937949 CATTATCAGCTCAATGTGGCTGG - Intergenic
1107656608 13:42598088-42598110 CTTTAAGAGGTCAAGGTGGGAGG - Intronic
1107927200 13:45274570-45274592 CTTTAGGTGGTCAAGGTGGGCGG - Intronic
1108190541 13:47934006-47934028 CGACATGTGCCCAAGGTGGCTGG + Intergenic
1111034688 13:82657049-82657071 GAGTATGTGCCCAAGGTGGCTGG + Intergenic
1112643552 13:101304679-101304701 CTTTAGGTGGCCAAGGTGGGTGG - Intronic
1114287667 14:21260394-21260416 CTTTATGTGATTAAGGTAGAAGG + Intronic
1116866106 14:50032910-50032932 CTTTGTGTGGCCAAGGTGGGAGG - Intergenic
1118290626 14:64518470-64518492 CTTTATGTCTTAGAGGTGGCAGG + Intronic
1119042656 14:71289108-71289130 CTACATGTGTCCAAGGTGGCGGG + Intergenic
1120020423 14:79524113-79524135 CTTTGTTTGCTGAAGGTCGCAGG - Intronic
1120234765 14:81877129-81877151 CTCTTTCTTCTCAAGGTGGCAGG - Intergenic
1121950392 14:98166558-98166580 ATTAATGTGCTCAAGTTGACAGG - Intergenic
1122187023 14:100007129-100007151 CGATATGTGCTCATGGTGGTCGG + Intronic
1122199217 14:100112127-100112149 CTATATGAGCTGAAGCTGGCAGG - Intronic
1122997861 14:105275290-105275312 CCTTAGGTGCTCAAGGTGGCAGG - Intronic
1123578628 15:21696495-21696517 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1123615255 15:22138977-22138999 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1123798206 15:23794862-23794884 CTGTATGTGCTCAGGGCAGCTGG - Intergenic
1126059730 15:44768738-44768760 CTTTAGGAGGTCAAGGTGGGAGG - Intergenic
1127229043 15:56968773-56968795 TGACATGTGCTCAAGGTGGCTGG + Intronic
1128041433 15:64577909-64577931 CTTTAGGAGGTCAAGGTGGGAGG + Intronic
1128571754 15:68738692-68738714 CTTTATGAGGCCAAGGTGGGAGG - Intergenic
1128635159 15:69298436-69298458 CTTGGAGTGCTCAGGGTGGCGGG - Intergenic
1202987498 15_KI270727v1_random:430740-430762 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1132502471 16:290611-290633 CTTTATGTGCTCAAGGTGGCAGG - Intronic
1134334589 16:13286239-13286261 CTATATGTGCTCAGCGTGGTTGG - Intergenic
1135538446 16:23312211-23312233 CTTTGTGAGCTCGAGGTGGGAGG - Intronic
1137250211 16:46735884-46735906 CTTTGGGTACTGAAGGTGGCAGG - Intronic
1137833596 16:51568867-51568889 ATTAAGGTGCTCAAGGTGACAGG - Intergenic
1138513499 16:57522495-57522517 CTTTGGGAGCTCGAGGTGGCAGG - Intronic
1138571244 16:57874666-57874688 CTTTGGGAGCCCAAGGTGGCAGG + Intergenic
1139539030 16:67599974-67599996 CTTGGTGTGCTCAGGGGGGCTGG + Intronic
1139575436 16:67839005-67839027 CTTTAGGAGGCCAAGGTGGCCGG + Intronic
1140059915 16:71559687-71559709 CAACATGTGCCCAAGGTGGCTGG + Intronic
1140229814 16:73108510-73108532 CTTTGTGAGGTCAAGGTGGGAGG - Intergenic
1140921597 16:79543478-79543500 CTGGATGTTCTCAAGATGGCGGG + Intergenic
1142731646 17:1862660-1862682 CTTTAGGAGGTCAAGGTGGGCGG - Intronic
1143168364 17:4910683-4910705 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1143659233 17:8314655-8314677 CTTTGTGAGGCCAAGGTGGCAGG + Intronic
1144477757 17:15603353-15603375 ACTTGTGTGATCAAGGTGGCTGG - Intronic
1144920537 17:18760330-18760352 ACTTGTGTGATCAAGGTGGCTGG + Intronic
1145360626 17:22209156-22209178 CTTTAGGAGCCCAAGGTGGGAGG + Intergenic
1145827585 17:27888796-27888818 CTACATGTGCTCCAAGTGGCAGG + Intronic
1145988472 17:29063381-29063403 CTTTGTGTGGCCAAGGTGGGAGG + Intergenic
1149390583 17:56186285-56186307 TTTTATATGCTCAAGAAGGCTGG - Intronic
1150451124 17:65270022-65270044 CTTTAGGAGGTCAAGGTGGGCGG + Intergenic
1150895752 17:69208791-69208813 CTTTAGGTGGCCAAGGTGGGAGG + Intronic
1151273988 17:73020116-73020138 CTTTATGTACTGAAGATGACGGG + Intronic
1151315613 17:73320251-73320273 CTTTCTGTGCCCAGGATGGCTGG - Intergenic
1151908830 17:77067801-77067823 CAGCATGTGCCCAAGGTGGCTGG + Intergenic
1151982657 17:77522980-77523002 CGATATGTGCCCAAGGTGGTTGG - Intergenic
1153138258 18:1942166-1942188 GAATATGTGCTCAAGGTGGTTGG + Intergenic
1153925268 18:9830254-9830276 CTTTAGGAGGTCAAGGTGGGAGG - Intronic
1155226265 18:23732174-23732196 CTTGATGAGGTCAAGGTTGCTGG + Intronic
1159527876 18:69617209-69617231 CTTTAGGAGGTCAAGGTGGGAGG + Intronic
1159806212 18:72961348-72961370 CATTCTGCCCTCAAGGTGGCGGG - Intergenic
1160402874 18:78623648-78623670 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1160974476 19:1785885-1785907 CTTTAGGAGGTCAAGGTGGGAGG + Intronic
1161968448 19:7561797-7561819 CCTTCTGTGCTCAGGATGGCTGG + Intergenic
1162355243 19:10179475-10179497 CTTTGGGTGGCCAAGGTGGCTGG - Intronic
1163227396 19:15974025-15974047 CTTTAGGTGGCCAAGGTGGGTGG + Intergenic
1163542679 19:17920559-17920581 CTTTGGGTGGCCAAGGTGGCTGG - Intergenic
1164221717 19:23200783-23200805 CTTTGTGAGCTCCAGGTGGGTGG + Intergenic
1166325599 19:42048793-42048815 CTTTAGGAGGTCAAGGTGGGTGG + Intronic
1168288255 19:55345104-55345126 TCTCGTGTGCTCAAGGTGGCTGG - Intronic
925714698 2:6773258-6773280 CCTTTTGTGCTCAACGTGGCCGG + Intergenic
926348385 2:11970807-11970829 TGATATGTGCCCAAGGTGGCTGG - Intergenic
927142395 2:20139490-20139512 CCTTGTGTCCTCAAGGTGCCTGG + Intergenic
927829937 2:26341133-26341155 CTTTGTGTGGCCAAGGTGGGTGG + Intronic
927904064 2:26844870-26844892 CTTTAGGAGGTCAAGGTGGGAGG - Intergenic
928297064 2:30092766-30092788 GAGCATGTGCTCAAGGTGGCTGG - Intergenic
929595048 2:43170529-43170551 CTTGAGGGGCTCCAGGTGGCAGG - Intergenic
931310294 2:61072326-61072348 CTTTAGGAGGTCAAGGTGGAAGG + Intronic
931366671 2:61625193-61625215 CTTTGGGTGGTCAAGGTGGGTGG + Intergenic
931706099 2:64947734-64947756 CTTCATTTGCTCAAGGAGTCGGG - Intergenic
932106471 2:68947831-68947853 CTTTGGGAGCTCAAGGTGGGTGG - Intronic
933466072 2:82654094-82654116 CTTTAGGCGGTCAAGGTGGGAGG - Intergenic
934133154 2:88969214-88969236 AAATATGTGCCCAAGGTGGCTGG - Intergenic
934850733 2:97699350-97699372 CTTTAGGAGGTCAAGGTGGGCGG + Intergenic
935558298 2:104534837-104534859 CTTTGTGAGGTCAAGGTGGGTGG + Intergenic
936107105 2:109633876-109633898 CTTTAGGAGGTCAAGGTGGGTGG + Intergenic
936400170 2:112158816-112158838 CTTTGGGTGGTCAAGGTGGGTGG - Intronic
937458164 2:122062064-122062086 CTTTTTGTGCTGATGGTGTCTGG + Intergenic
937908051 2:127061956-127061978 CTCTCTGTGCTCAGGGAGGCAGG - Intronic
941497537 2:166224693-166224715 CTTAGTGTGGTCCAGGTGGCAGG + Intronic
942304211 2:174589974-174589996 CTTTGGGTGGTCAAGGTGGGAGG + Intronic
944479333 2:200139338-200139360 CTTTAGTAGCTTAAGGTGGCTGG - Intergenic
945812980 2:214570604-214570626 CTTTAGGAGGTCAAGGTGGGTGG - Intronic
947424280 2:229969017-229969039 CTTTAAGAGGCCAAGGTGGCTGG - Intronic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
947999060 2:234552826-234552848 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1170128153 20:12988554-12988576 ATTTATGGCCTCAAGGAGGCTGG + Intergenic
1170984853 20:21248041-21248063 CTTTGGGTGGTCAAGGTGGGTGG + Intergenic
1171091955 20:22293804-22293826 CTTTATGTAGTCAAGCTGCCTGG - Intergenic
1172158946 20:32851328-32851350 CTTTAGGAGGTCAAGGTGGGAGG - Intergenic
1172263464 20:33590007-33590029 CTTTGTGAGGCCAAGGTGGCAGG + Intronic
1172269128 20:33643330-33643352 CTTTAGGAGGTCAAGGTGGGAGG + Intronic
1172338635 20:34137754-34137776 CTTTAGGAGATCAAGGTGGGAGG + Intergenic
1172715108 20:36957284-36957306 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1173250951 20:41364002-41364024 TTTTCTGTGCTTAAGGTGACAGG + Intronic
1173613530 20:44388195-44388217 CTTTAGGTGGCCAAGGTGGGAGG - Intronic
1173794190 20:45847485-45847507 CTTTAGGAGGTCAAGGTGGGTGG + Intronic
1177090028 21:16756229-16756251 CGTTGTGTGCTGAAGGTAGCAGG + Intergenic
1177288935 21:19085260-19085282 CTTTAGGAGGTCAAGATGGCAGG - Intergenic
1177619536 21:23569037-23569059 CTTTATGTTCTCAAGTTGTTTGG + Intergenic
1179008159 21:37532438-37532460 CTTTAGGAGGCCAAGGTGGCTGG + Intergenic
1181110122 22:20597581-20597603 CTTTGTGAGGTCAAGGTGGGTGG - Intergenic
1182286483 22:29251443-29251465 CTTTAAGTGGCCAAGGTGGGAGG - Intronic
1183843609 22:40521739-40521761 CTTTGTGAGGTCAAGGTGGGTGG - Intronic
1183961917 22:41416375-41416397 CTTTAGGAGGTCAAGGTGGGTGG + Intergenic
953584347 3:44186348-44186370 CTTTCTGTCCTTCAGGTGGCTGG - Intergenic
953723740 3:45379771-45379793 CTTTGGGAGCCCAAGGTGGCAGG - Intergenic
955295739 3:57733353-57733375 CTTTGTGTGGCCAAGGTGGGTGG + Intergenic
956195454 3:66649759-66649781 CCTTCTGTGCTCCAAGTGGCCGG - Intergenic
957216087 3:77321271-77321293 CTTTAAGAGGTCAAGGTGGGAGG + Intronic
959558657 3:107753430-107753452 TTTTAAATGCTCAAGGTTGCTGG - Intronic
960405247 3:117252003-117252025 CTTTATCTGCTCATGGTAACAGG + Intergenic
960474821 3:118110841-118110863 ATTTGTGTGCTAAAGGTGGGTGG - Intergenic
960985157 3:123274289-123274311 CTTTGGGAGCTCAAGGTGGGTGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962772699 3:138627939-138627961 CTGTATGTGCACAAGGAGTCTGG - Intronic
964276647 3:155015563-155015585 CGACATGTGCTCAAGGTGGTTGG - Intergenic
964320668 3:155493627-155493649 CTTTGTGAGGTCAAGGTGGGCGG - Intronic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
969186756 4:5480320-5480342 ATATATGTGCCCAAGGTGGTCGG + Intronic
969272351 4:6111357-6111379 CTTTCTGTGCTCAGCCTGGCTGG + Intronic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971539786 4:27801437-27801459 ATTTATGTCCTCCAGGAGGCAGG - Intergenic
971912152 4:32808716-32808738 CTTTATGAGGCCAAGGTGGGAGG + Intergenic
972041658 4:34608431-34608453 CTTTAAGAGTTCAAGGCGGCCGG - Intergenic
972759934 4:42093131-42093153 AATTATCTGGTCAAGGTGGCAGG - Intergenic
975029063 4:69591229-69591251 GTATATGTGCCCAAGGTGGCTGG + Intronic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
978423077 4:108554606-108554628 CAACATGTGCCCAAGGTGGCAGG - Intergenic
978919784 4:114169461-114169483 CTTTTTGACATCAAGGTGGCCGG + Intergenic
978951290 4:114562223-114562245 CAACATGTGCCCAAGGTGGCTGG + Intergenic
979236098 4:118402018-118402040 CTTTGTGAGGTCAAGGTGGGTGG + Intergenic
979370294 4:119877826-119877848 CATCATGTGCCCAAGGTGGTCGG - Intergenic
981072214 4:140555614-140555636 TTTTAGCTGCTCATGGTGGCGGG - Intergenic
981557653 4:146012803-146012825 CTTTCTGAGGTCAAGGTGGGTGG - Intergenic
985311677 4:188608189-188608211 CATCATTTACTCAAGGTGGCAGG + Intergenic
985614121 5:909350-909372 CTTTCTGTCCTCAGGGTGCCTGG + Intronic
986443803 5:7803653-7803675 CTTTAGGTGGCCAAGGTGGGAGG + Intronic
987242833 5:16018383-16018405 CTTTATGTGTTCAAAGAGGTGGG - Intergenic
988303490 5:29464814-29464836 CTTTAGGAGGCCAAGGTGGCTGG + Intergenic
988649182 5:33129712-33129734 CTTTAAGTGCTAAAGGAGCCTGG + Intergenic
990964301 5:61428612-61428634 CTTTAGGGGGTCAAGGTGGGAGG - Intronic
991435268 5:66591822-66591844 CTTTGTCTCCTCAAGGTGGTTGG + Intergenic
991968867 5:72119124-72119146 CTTTCTGTACACAAGGTGGGTGG + Intronic
992889119 5:81187746-81187768 CTTAGTGTGCTCAAGGTCTCAGG + Intronic
993573275 5:89569250-89569272 ATTTAAGTGGTCAAGGTGGAAGG - Intergenic
993971832 5:94429543-94429565 CTGTCTGTGGTCAATGTGGCTGG + Intronic
994195932 5:96923210-96923232 CTTTGTGAGCCCAAGGCGGCAGG - Intronic
995513032 5:112926844-112926866 CTTTGTGGGGTCAAGGTGGGAGG - Intergenic
998034521 5:138903292-138903314 GTTTATGTGCTTAAGTTGGGCGG + Intronic
999309177 5:150540570-150540592 CTTTAGGAGGCCAAGGTGGCTGG + Intronic
999558476 5:152772436-152772458 CAATATGTGCCCAAGGTGGTTGG + Intergenic
999726417 5:154442081-154442103 CTACATGTGCCCAAGGTGGTTGG - Intergenic
999991363 5:157053141-157053163 CTTTATGGGGCCAAGGTGGGTGG + Intronic
1000334662 5:160233221-160233243 CTTTAGGAGGTCAAGGTGGGCGG - Intronic
1002312713 5:178324381-178324403 TTTTATGCGCTCAGGATGGCTGG + Intronic
1002469391 5:179426458-179426480 CTTTATGGGAGCAAGGTGGAGGG + Intergenic
1003181857 6:3798935-3798957 CTTTATTTTCTCTAAGTGGCTGG - Intergenic
1003480688 6:6529843-6529865 CTTTGGGAGGTCAAGGTGGCAGG - Intergenic
1005020982 6:21418581-21418603 CTTTAGGAGGTCAAGGTGGGCGG - Intergenic
1006355275 6:33552777-33552799 CTTTGGGAGCTCAAGGTGGGTGG - Intergenic
1007596196 6:43052789-43052811 CCTTGTGTGCTCCAGGTGCCAGG - Exonic
1007613668 6:43167376-43167398 CTTTTTGAGGTCAAGGTGGGAGG - Intergenic
1007648516 6:43401220-43401242 CATTAGCTGCTCATGGTGGCGGG + Intergenic
1009964483 6:70564445-70564467 TTTTATGTGGTCTGGGTGGCAGG - Intergenic
1010134828 6:72539148-72539170 CTTTAAGAGGTCAAGGTGGGTGG - Intergenic
1012118087 6:95330297-95330319 GTGTATGTGCCCAAGGTGGTTGG + Intergenic
1012483179 6:99690341-99690363 CTTTGTTTGCTCAAGGTTGTAGG - Intergenic
1018036262 6:159884680-159884702 CTTTAGGAGGCCAAGGTGGCTGG - Intergenic
1018706676 6:166468551-166468573 CTTTATGTCCTCATGGAGTCCGG - Intronic
1018801177 6:167223435-167223457 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1020036952 7:4969660-4969682 CTTTAGGAGGTCAAGGTGGGAGG + Intergenic
1020340951 7:7110530-7110552 CAACATGTGCTCAAGGTGGCTGG - Intergenic
1021099078 7:16568222-16568244 CTTTATGATTACAAGGTGGCTGG + Intronic
1021341353 7:19466407-19466429 CTTTATGGGCTCATGGTTTCTGG + Intergenic
1024122129 7:46254135-46254157 GAATATGTGCCCAAGGTGGCTGG - Intergenic
1024547721 7:50536353-50536375 CTACATGTGCCCAAGGTGGTTGG - Intronic
1026183386 7:68061804-68061826 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1026556913 7:71416366-71416388 CTTTAGGAGCCCAAGGTGGGTGG + Intronic
1026581095 7:71617888-71617910 CTTTAGGAGGTCAAGGTGGGTGG - Intronic
1026869948 7:73844455-73844477 CGTCATGTGCCCAAGGTGGTCGG - Intergenic
1028754929 7:94423836-94423858 CTTTAGGAGGTCAAGGTGGGTGG - Intronic
1029140772 7:98408292-98408314 CTTTAGGAGGTCAAGGTGGGAGG + Intergenic
1029812042 7:103059014-103059036 CTTTATGAGACCAAGGTGGGAGG + Intronic
1030026830 7:105332518-105332540 CTTTGTGAGGTCAAGGTGGTTGG + Intronic
1030951222 7:115792509-115792531 CTTTGGGAGGTCAAGGTGGCAGG + Intergenic
1031933567 7:127712400-127712422 CTTTGGGAGCTCAAGGTGGGAGG - Intronic
1031965080 7:128021958-128021980 CTTTGTGAGCCCAAGGTGGGCGG + Intronic
1032394493 7:131579529-131579551 CTTTAGGAGGTCAAGGTGGGTGG + Intergenic
1032727938 7:134609528-134609550 CTTTGTGAGGTCAAGGTGGGCGG + Intergenic
1033178684 7:139152368-139152390 CTTTGGGTGCCCAAGGTGGAAGG - Intronic
1036213557 8:6861909-6861931 CGTCATGTGCCCAAGGTGGTTGG - Intergenic
1036427543 8:8659340-8659362 CTTTAGGAGGTCAAGGTGGGTGG - Intergenic
1037404128 8:18523359-18523381 CTTTGGGAGCTCAAGGTGGAAGG + Intergenic
1037852594 8:22344622-22344644 CTTTGTGAGGTCAAGGTGGGAGG + Intronic
1038009638 8:23464831-23464853 CGCCATGTGCCCAAGGTGGCTGG + Intergenic
1038759266 8:30371520-30371542 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1039351686 8:36770496-36770518 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1039956959 8:42215060-42215082 CTGCATGTGCTCAGGGTGACAGG + Intergenic
1040416379 8:47199370-47199392 CTTTACGAGGTCAAGGTGGTAGG - Intergenic
1042893672 8:73642279-73642301 CTTTATGAGGCCAAGGTGGGTGG + Intronic
1043406175 8:79936101-79936123 CTTTAGGAGGTCAAGGTGGGAGG + Intronic
1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG + Intronic
1045116239 8:98984240-98984262 CTTTGGGTGGTCAAGGTGGAAGG + Intergenic
1047774068 8:128054612-128054634 CTTGATGGGTTCAATGTGGCTGG + Intergenic
1048053003 8:130836975-130836997 CTTTAGGAGGTCAAGGTGGGTGG - Intronic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1049959973 9:728981-729003 CAACATGTGCCCAAGGTGGCTGG - Intronic
1052184697 9:25578007-25578029 CTTTGGGTGGTCAAGGTGGGTGG - Intergenic
1053707670 9:40770827-40770849 CTTTAGGAGGTCAAGGTGGGCGG - Intergenic
1054417583 9:64891613-64891635 CTTTAGGAGGTCAAGGTGGGCGG - Intergenic
1055110605 9:72555862-72555884 CTTTGGGTGGTCAAGGTGGGTGG - Intronic
1056183471 9:84108221-84108243 CTTTCTGCACCCAAGGTGGCAGG - Intergenic
1058436381 9:104967742-104967764 CTTTGGGAGCTCAAGGTGGGTGG + Intergenic
1059551638 9:115234909-115234931 CTTTGGGAGCTCAAGGTGGAAGG - Intronic
1060279683 9:122207454-122207476 CTCTATGTCCACAAAGTGGCTGG + Intronic
1061361743 9:130147654-130147676 CTTTGTGAGCCCAAGGTGGGCGG + Intergenic
1061641206 9:131957833-131957855 CTTTAGGAGGTCAAGGTGGGAGG + Intronic
1185917183 X:4048329-4048351 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1186249332 X:7649304-7649326 CTTTAGGAGGCCAAGGTGGCTGG + Intergenic
1188939559 X:36219869-36219891 CAACATGTGCTCAAGGTGGTCGG - Intergenic
1190053614 X:47169807-47169829 CTTCAAGTGCCCAAGTTGGCTGG - Intronic
1190408276 X:50109570-50109592 CAACATGTGCTCAAGGTGGTAGG - Intergenic
1190951818 X:55153154-55153176 CAACATGTGCTCAAGGTGGTCGG - Intronic
1191928809 X:66345442-66345464 CTTTTTTTGCTCATGGTGTCTGG + Intergenic
1194502342 X:94697295-94697317 CAATATGTGTTCAAGGTGGTCGG + Intergenic
1195401227 X:104463626-104463648 CGATATGTGCCCAAGGTGGTCGG - Intergenic
1196324812 X:114390378-114390400 ATTTATGTGTTAAATGTGGCTGG + Intergenic
1197483993 X:127024409-127024431 CTTTGGGTGGTCAAGGCGGCCGG - Intergenic
1197881264 X:131169401-131169423 CTTAAGGTGCTCAAGATGCCTGG - Intergenic
1199089878 X:143679297-143679319 CTTTGGGTGGTCAAGGTGGGTGG + Intergenic
1199490688 X:148397223-148397245 CTTTGTCTGTTCAAGGTGGGAGG - Intergenic
1200314730 X:155119896-155119918 CTTTCTGTGCTCATGGTTGGGGG + Intronic
1201982896 Y:19926713-19926735 CTTTAGGAGCCCAAGGTGGGTGG + Intergenic