ID: 1132502883

View in Genome Browser
Species Human (GRCh38)
Location 16:292448-292470
Sequence AAGGGTCTGAACCCTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132502876_1132502883 15 Left 1132502876 16:292410-292432 CCTTTAATGACTTGAGACCACAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132502883 16:292448-292470 AAGGGTCTGAACCCTGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 152
1132502880_1132502883 -2 Left 1132502880 16:292427-292449 CCACACAGGCTTTCAGCTGGGAA 0: 1
1: 0
2: 2
3: 23
4: 303
Right 1132502883 16:292448-292470 AAGGGTCTGAACCCTGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132502883 Original CRISPR AAGGGTCTGAACCCTGATGC TGG Intronic
901279412 1:8021859-8021881 AAGGGCCTGGACACTGAGGCCGG - Intronic
901535438 1:9879783-9879805 AAGGGTCTGAGCCCTGTAGACGG - Intronic
901739767 1:11334516-11334538 AAGTGTCTGCACCCTGGGGCTGG + Intergenic
903268604 1:22173890-22173912 GAGGGTCTGAACTTGGATGCCGG + Intergenic
904095516 1:27973852-27973874 AAGGGTCTGATCTTTGACGCAGG - Exonic
904933156 1:34106618-34106640 CAGGCTCTGACCCCTGGTGCTGG - Intronic
905012329 1:34755752-34755774 AAGGGTCTGAGGCCTAAGGCTGG + Intronic
906137072 1:43507128-43507150 AGGGATCTGACCCCTGATGGTGG - Intergenic
920313266 1:205060961-205060983 CGGGGTCTGCACCCTGAAGCTGG - Intronic
921166776 1:212513609-212513631 TAGGGTTTGAATCCTGGTGCTGG + Intergenic
921337856 1:214106771-214106793 AATGTTCTGAATCCTGATGTGGG + Intergenic
924759918 1:246974235-246974257 AAGAGTCTGAACTATGCTGCAGG + Intronic
1064227994 10:13504345-13504367 AAGAGTCTGAACCCTAACCCGGG + Intronic
1064772531 10:18738262-18738284 AATGATTTGAGCCCTGATGCTGG + Intergenic
1067165160 10:43860252-43860274 AGAGGCCTGAACCCTGGTGCTGG - Intergenic
1069689543 10:70340827-70340849 CAGGGTCTGAAGCCTGGTCCTGG - Intronic
1069954202 10:72039946-72039968 AAGCTTCTGAACCGTGACGCCGG + Intergenic
1069975940 10:72213388-72213410 TAGTGTCTGAACCATTATGCAGG + Intronic
1071562476 10:86655023-86655045 AAAGGTCTGAACTCTGCTGTGGG + Intronic
1076849282 10:133085314-133085336 AAGCGTCTCAACCATGTTGCAGG - Intronic
1077424121 11:2466466-2466488 AAGGGGCTGGCCCCTGTTGCTGG + Intronic
1079212605 11:18476425-18476447 AAGGATCTGAACCCAGATATAGG + Exonic
1079499984 11:21092287-21092309 AAGGGTCAGCACCCTGTAGCTGG + Intronic
1080174580 11:29346769-29346791 AAGGGTCTGAAGCCAGGTGATGG + Intergenic
1080425489 11:32150387-32150409 AAGTTTCTGAACCCTGTTGAAGG + Intergenic
1081472848 11:43392977-43392999 AAGGCTCTGAATCCTGATTGAGG + Intronic
1083712019 11:64555336-64555358 AAGGCTCTGAAGCCAGATGTGGG - Intergenic
1085808984 11:79663278-79663300 AAGGGTCTGAACCCATATGGTGG - Intergenic
1089693345 11:120200090-120200112 AAGGGTCAGAACCGTGATCTTGG + Intergenic
1089695979 11:120216603-120216625 GGGGGTCTGAACCCTCAGGCAGG - Intronic
1090324397 11:125872063-125872085 GGGGGTCTTATCCCTGATGCAGG + Intergenic
1091117134 11:133023966-133023988 GAGGGTCTGATCCATGCTGCTGG - Intronic
1092200013 12:6575596-6575618 AAGGGTCTGGGCTGTGATGCTGG - Intronic
1093081287 12:14814779-14814801 ACGGGTCTGAAGACTGAAGCTGG - Intronic
1094312976 12:29106123-29106145 AATTGCCTGAACCCTGATGTTGG + Intergenic
1095046700 12:37515260-37515282 AATGGTGTGAACCCTGAAGGTGG - Intergenic
1096156890 12:49346007-49346029 AAGGGTCTGAGCTGTGGTGCGGG - Intergenic
1097164819 12:57078425-57078447 GAGGGTCTGGGCCCTGAAGCGGG - Intronic
1097719495 12:63004333-63004355 AAGGATCTGAACTCTGATATAGG + Intergenic
1098073479 12:66700739-66700761 AGGGGCCTGAACCAGGATGCTGG + Intronic
1102816728 12:115871946-115871968 GAGGGTCTAATCCCTGAGGCAGG + Intergenic
1103854230 12:123954619-123954641 ACGGGTCTGTACACTGATGAGGG + Intronic
1106313877 13:28577030-28577052 GAAGGTCTGAACCCAGATGGTGG + Intergenic
1108487711 13:50943829-50943851 CAGGGTCTGGACACTGATGAGGG + Intronic
1111868594 13:93801475-93801497 AAATGTCTGACCCCTGAAGCAGG + Intronic
1119218360 14:72886389-72886411 AAGGGTCTGGAAACTGATGGTGG + Intronic
1122438975 14:101717245-101717267 AAGGGGCTGGACCCTCAAGCCGG - Intergenic
1122882122 14:104694917-104694939 CAGGACCTGAACCCTGAAGCCGG + Intronic
1123414301 15:20083669-20083691 AAAGTTCTGAACCCTGTTGGAGG - Intergenic
1123523643 15:21090780-21090802 AAAGTTCTGAACCCTGTTGGAGG - Intergenic
1127462022 15:59207721-59207743 AAGGATCTGAACTCTGATATAGG + Exonic
1127672848 15:61212353-61212375 AAGGGTCTAAAACCTGACTCTGG + Intronic
1127833941 15:62774862-62774884 AAGGATCTGTACTCTCATGCAGG - Intronic
1128084465 15:64876272-64876294 AAGGGTGAGAACACTTATGCGGG - Intronic
1128812406 15:70582142-70582164 AAGGCTCTGAACTCTGACTCTGG + Intergenic
1128862866 15:71089351-71089373 AAGGGTCTGTTGCGTGATGCTGG - Intergenic
1129413891 15:75364188-75364210 AAGGGGCAGAACCCTGCTGCAGG - Exonic
1131990749 15:98090263-98090285 AAGGGTGTGAACCCGGAAGGCGG + Intergenic
1132099377 15:99013013-99013035 AAGGGTGTGAACCCGGAAGGCGG - Intergenic
1132474762 16:128914-128936 AAGGGTATGAACCCTGTATCTGG + Intronic
1132502883 16:292448-292470 AAGGGTCTGAACCCTGATGCTGG + Intronic
1132585476 16:704352-704374 AAGGGTCTGGCCCCAGATGAGGG + Intronic
1132617404 16:848468-848490 GAGGGTCTGGGCCCTGAGGCAGG + Intergenic
1133635662 16:7662660-7662682 AAGAGTCTGAAAAATGATGCTGG + Intronic
1135993688 16:27232635-27232657 CCGGGTCTGAACCCTGAGCCAGG - Intronic
1141682362 16:85552110-85552132 AATGGTGTGAACCCTGAAGGCGG - Intergenic
1143018195 17:3903066-3903088 ATGGGTCTGTCCCCTGATACTGG - Intronic
1147391259 17:40110720-40110742 GAGGGACTGGACCCTGAGGCAGG + Intergenic
1149610776 17:57956295-57956317 AAGGGTCTGCACCCTCCTCCTGG + Intergenic
1151324752 17:73372253-73372275 AAGGGACTGAGCCCAGATCCTGG + Intronic
1152736488 17:81999879-81999901 GAGGGGCTGGACCCTGACGCCGG - Intronic
1154297016 18:13160478-13160500 AAGGGCCTGTGGCCTGATGCAGG + Intergenic
1156994229 18:43447242-43447264 AAGGGACTGAATCATGAAGCTGG + Intergenic
1157582482 18:48781617-48781639 CAGGCCCTGAACCCTGCTGCTGG - Intronic
1167217805 19:48176482-48176504 CAGGGTCTGGACCCTCATTCTGG + Intronic
926678947 2:15649625-15649647 CAGTTTCTGAACCCTGGTGCTGG - Intergenic
926939138 2:18116614-18116636 AAGGGTCTGGAGCCTGATTAGGG - Intronic
929249436 2:39736701-39736723 AAGGGCCTGAACCCGGCTGATGG + Exonic
932422652 2:71610793-71610815 AAGGGTCTGAGCCAGGAGGCAGG + Intronic
935341625 2:102064257-102064279 AAGGGCCTGAAGTCTGATGGAGG + Intergenic
935622586 2:105142770-105142792 AACTGTCTGAACCCTAGTGCAGG - Intergenic
937764222 2:125640864-125640886 AAGGGTCAGAAGCCTGGTGAAGG + Intergenic
940052812 2:149481952-149481974 CAGGGTCTGAGCCCTGATCTGGG - Intergenic
942688049 2:178554866-178554888 AAGGATCTGTACTCTGATGGTGG + Exonic
945268118 2:207911188-207911210 AGGGGGCTGAACCCAGATGAGGG + Intronic
946627521 2:221629685-221629707 AAGAGTTTGAGCCCTGATTCAGG + Intergenic
948482897 2:238261643-238261665 TAGGCTCTGAACCCTGGTCCTGG - Intronic
1175271314 20:57736046-57736068 CAGGGTGTGAAACCTGAGGCAGG - Intergenic
1175934419 20:62508451-62508473 GGGGGTCTGCCCCCTGATGCAGG - Intergenic
1182545815 22:31075899-31075921 AAAGTTCTGAACCCTGTTGGAGG + Intronic
1184178981 22:42806438-42806460 TGGGGTCTGAACCCTGAAGAGGG + Intronic
950160505 3:10757195-10757217 TAGGGTCTGGGCCGTGATGCAGG - Intergenic
956262496 3:67360236-67360258 AACGTTCTGAACTCTGATGGAGG + Intergenic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
962016267 3:131443631-131443653 AAGGAGGTGAACCCTGATACAGG + Intergenic
962764960 3:138553391-138553413 AATGGTGTGAACCCTGAAGGTGG + Intronic
969336666 4:6514577-6514599 AATGGTCTGAACTATTATGCTGG + Intronic
977916250 4:102597418-102597440 AGGTGTCAGAACACTGATGCTGG + Intronic
985703835 5:1389343-1389365 AAGGGCCAGAACCCAGAAGCTGG + Intergenic
985925284 5:3011296-3011318 AGGGGTCAGAACCCTGAGCCGGG - Intergenic
986126009 5:4882848-4882870 AAGTGTCTGAATCCAGATTCTGG + Intergenic
986643784 5:9896552-9896574 AAGTGGCTGAACCCTGAGGGAGG - Intergenic
987507215 5:18789259-18789281 AATGGAGTAAACCCTGATGCAGG + Intergenic
990912575 5:60867339-60867361 AATGGCCTGAACCCTGAAGGCGG - Intergenic
994175052 5:96702128-96702150 AAGGCTCTGAACCCTGAACTTGG - Intronic
1000019039 5:157303128-157303150 CACGTTCTCAACCCTGATGCAGG - Intronic
1000591175 5:163159341-163159363 AATGGTGTGAACCCAGATGGTGG - Intergenic
1002345723 5:178546484-178546506 CAGGGTCTGCACCCTCATCCTGG - Intronic
1002356140 5:178630449-178630471 CTGGGTCTGAATCCTGATTCTGG - Intronic
1002775075 6:321495-321517 GAGGGTCTGAACTGGGATGCTGG + Intronic
1003183080 6:3808387-3808409 AAGGGTCAGAACCCAGTCGCTGG + Intergenic
1003464164 6:6362432-6362454 AAAAGGCTGAACCATGATGCTGG - Intergenic
1006506644 6:34493236-34493258 GAGTGTCTTCACCCTGATGCTGG + Intronic
1006811382 6:36822498-36822520 AAGGGTCTGAAGTGTGAGGCAGG + Intronic
1012383230 6:98645810-98645832 AAGGGTCTGAACCCAGGTCATGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016349277 6:143149438-143149460 AATGGTGTGAACCCTGAAGGCGG + Intronic
1016995829 6:149962061-149962083 ACGTGTCTGAATCCTGATGGTGG + Intergenic
1017729110 6:157299354-157299376 AAGAATCTGAACTCTGATACAGG - Intronic
1019033127 6:169030642-169030664 AAGGGGCAGACCCCTGATGTGGG - Intergenic
1019526587 7:1483169-1483191 AGGGGGCGGAACCCTCATGCTGG - Intronic
1019742678 7:2682589-2682611 AGGGGTCTGAATCCTGGTCCAGG - Intronic
1019899194 7:4006810-4006832 CAGACTCTGAACCCTGAGGCTGG + Intronic
1023862356 7:44224336-44224358 AAGGGCATGATCCCTGATGGAGG + Intronic
1023991905 7:45133547-45133569 CAGGGTCACAACCCTGGTGCAGG + Intergenic
1024135944 7:46408252-46408274 AAGTGACTGAACCTTGATGGTGG + Intergenic
1024363278 7:48492066-48492088 AGATTTCTGAACCCTGATGCAGG + Intronic
1028202829 7:87982404-87982426 AAGGGTCTGGGCCCTGAGGCAGG + Intronic
1029422629 7:100479038-100479060 AAGGGTCTGGAGACTGATGTGGG + Exonic
1035013022 7:155737628-155737650 AAGGGTCTCGATCCTGAGGCGGG - Exonic
1036174831 8:6527422-6527444 AAGGGTCAGAAACCTCATGAGGG - Intronic
1036188340 8:6645211-6645233 TAAGTTCTGATCCCTGATGCTGG + Intergenic
1036706267 8:11049336-11049358 AGGGCTCTGAACCCTCCTGCCGG - Intronic
1037551125 8:19972700-19972722 AAGGATCTGAGCCCTGATAAAGG - Intergenic
1038015720 8:23512959-23512981 AAGGACCTGAGCCCTGATGCCGG + Intergenic
1038410684 8:27356595-27356617 AAGGCTCTGCAGCCTGAAGCAGG + Intronic
1039736855 8:40342134-40342156 ACAGGTATGAACCATGATGCTGG - Intergenic
1040104605 8:43534631-43534653 AAGGGTCTGTGGCCTGAGGCAGG + Intergenic
1041973361 8:63768593-63768615 TAGGGTCTGCATCCTGAAGCAGG + Intergenic
1042803885 8:72751041-72751063 CAGGGCCTGACCCCTGATACAGG - Intronic
1044060673 8:87631332-87631354 CAGGCTCTGAACCCTGACCCAGG - Intergenic
1047419240 8:124692851-124692873 ATGGGTCTGCACCCTGCTGAAGG + Intronic
1049269572 8:141687135-141687157 GAGGCTCTGAGCCCTGATTCTGG - Intergenic
1049325847 8:142021061-142021083 GAGGGTGTGAACCCTGAGGCCGG - Intergenic
1049512435 8:143035933-143035955 AAGCGTCTGAACCCCGCTGCAGG + Intergenic
1051219186 9:14830760-14830782 AAGGGTCTTGGCCCTCATGCCGG - Intronic
1051409288 9:16772272-16772294 AAGGGTATCAACTCTGATACTGG - Intronic
1053447946 9:38167411-38167433 AAGGGTATGGACCCTGGAGCTGG - Intergenic
1058772115 9:108245539-108245561 AAGGGTCTGAAGCCAGATGCAGG + Intergenic
1059650129 9:116308541-116308563 AAGGGGCAGAACCAAGATGCAGG + Intronic
1061298505 9:129690377-129690399 TAGGATCTGAACCCTGATCAAGG + Intronic
1187530551 X:20092604-20092626 AAGCCTCTGAACCCTGTTGGAGG + Intronic
1188640132 X:32490710-32490732 AGGGGTAAGAACTCTGATGCTGG + Intronic
1189774942 X:44462222-44462244 AAGGGTCTGAAGGCTGCAGCTGG - Intergenic
1196862425 X:120040746-120040768 AGGGGTCTGACCACAGATGCAGG + Intergenic
1196880677 X:120195598-120195620 AGGGGTCTGACCACAGATGCAGG - Intergenic
1197745713 X:129931585-129931607 AGGGGTCAGAACCCTGTTGGGGG - Intergenic
1200241116 X:154494509-154494531 AAGGTGCTGCAACCTGATGCTGG - Intergenic
1200428125 Y:3045218-3045240 CAGGGTCTGACTCCTGATTCAGG - Intergenic
1202052887 Y:20798805-20798827 AAGGGTCTGAGCCTTAAGGCAGG - Intergenic