ID: 1132502892

View in Genome Browser
Species Human (GRCh38)
Location 16:292490-292512
Sequence TAGCCACAGCCTCCCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132502885_1132502892 8 Left 1132502885 16:292459-292481 CCCTGATGCTGGTTCGGCAGAAT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1132502886_1132502892 7 Left 1132502886 16:292460-292482 CCTGATGCTGGTTCGGCAGAATA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG 0: 1
1: 0
2: 2
3: 29
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132502892 Original CRISPR TAGCCACAGCCTCCCTGGAG TGG Intronic
900291541 1:1925735-1925757 TGGCTCCAGCCTCCCAGGAGGGG - Intronic
900635696 1:3663992-3664014 ATGCCACAGGCTCTCTGGAGAGG + Intronic
900815924 1:4845652-4845674 TGGCCCCATCCTCCCTGGACCGG - Intergenic
901559313 1:10057647-10057669 CAGCCTCAACCTCCCTGGGGAGG - Intronic
902219455 1:14955625-14955647 TACTCACAGCCTGACTGGAGGGG + Intronic
902619854 1:17644472-17644494 TAGCCACAGTCTCCCAGCTGGGG - Intronic
903640948 1:24860028-24860050 GAGCCTCAGCCTCCCTAGATGGG + Intergenic
904002685 1:27347824-27347846 CAGCCTCAGCCTCCCTGTCGTGG - Exonic
904714435 1:32456674-32456696 AAGCCACAGGGTCCCTGGAATGG + Intergenic
904866351 1:33582048-33582070 GAGCTCCAGCCTTCCTGGAGCGG + Intronic
907448071 1:54522273-54522295 TGGCCTCAGTCTCCCTGGTGGGG + Intergenic
909282085 1:73769854-73769876 TCCCCACACCCTCCCTGCAGTGG - Intergenic
910768618 1:90808405-90808427 TGGCCACAGCCCCATTGGAGAGG + Intergenic
915036627 1:152932974-152932996 TTGCCAAAGGCTTCCTGGAGGGG - Intergenic
915640804 1:157224481-157224503 TAGGCACAGCCCACTTGGAGGGG + Intergenic
916189711 1:162167105-162167127 AAGTCTCTGCCTCCCTGGAGAGG + Intronic
918303913 1:183228628-183228650 CAGACACAGCCTGCCTGGGGTGG - Intronic
921428479 1:215033744-215033766 TAACCACAGCCTACCTGCTGGGG - Intronic
921621840 1:217334108-217334130 GAGCTCCAGCCTCCCTGGTGGGG - Intergenic
922122108 1:222681746-222681768 TAGCCACTGCCACCATGGGGAGG + Intronic
922748468 1:228060040-228060062 GAGCCACAGCCCCCGTGGAAGGG - Exonic
923162738 1:231330616-231330638 TAGCCTCAACCTCCCTGGCCTGG - Intergenic
924243935 1:242063391-242063413 TAGGCACACATTCCCTGGAGGGG + Intergenic
1063856421 10:10259253-10259275 TAGCCAATGCCTCACTGGTGGGG + Intergenic
1067809903 10:49418249-49418271 TGGCCCCACCCTCCCTGGAAAGG + Intergenic
1068157831 10:53223513-53223535 TAGCCGCAGCCCATCTGGAGTGG - Intergenic
1070718760 10:78741880-78741902 CATCCATAGCCTTCCTGGAGAGG - Intergenic
1074188155 10:111114578-111114600 GAGTCACAGCCTGCCTGGCGGGG + Intergenic
1074543612 10:114385866-114385888 TACCTGCAGCCTCCCTGGAGTGG - Intronic
1075336070 10:121609612-121609634 TCACCACAGCTGCCCTGGAGAGG + Intergenic
1076260779 10:129063970-129063992 TGGCTGCAGGCTCCCTGGAGAGG - Intergenic
1077050543 11:564458-564480 TACCCATACCCTCCCTGGGGTGG - Intergenic
1077168784 11:1157206-1157228 CAGCCTCACCCTCCCTGGAGAGG - Intergenic
1077225560 11:1437743-1437765 CAGGCACAGCCTGCCTGGAAGGG + Intronic
1078470480 11:11582104-11582126 TAGGGAAAGCCTCCCTGGAGAGG + Intronic
1079152983 11:17918152-17918174 TACCCACAGGCACCATGGAGTGG - Intronic
1079668348 11:23135301-23135323 CTGCCACTGCCTCCCTGCAGTGG - Intergenic
1081623472 11:44632894-44632916 CAGCCAAAGCCTCCCGGGACAGG + Intergenic
1083633046 11:64105513-64105535 TGGCCACAGCCTGTGTGGAGGGG - Intronic
1083751082 11:64760900-64760922 TAGCCAAAGCCTCCAGGGAAGGG - Intergenic
1084000592 11:66293440-66293462 TTGCCACACCCTCCCTGGCAGGG - Intronic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085212325 11:74791948-74791970 CAGCAGCAGCCTGCCTGGAGTGG - Intronic
1085296680 11:75435351-75435373 CAGCCGCAGCCTCTCTTGAGGGG - Exonic
1087789698 11:102393212-102393234 TAGCCACAACTTCCCTGGTCGGG - Intergenic
1088813528 11:113406892-113406914 TACCCACTTGCTCCCTGGAGAGG + Intergenic
1091816864 12:3445295-3445317 TAGCCACTGCCTCCCCTGGGAGG + Intronic
1092177560 12:6421053-6421075 TAAGGACAGCCTCTCTGGAGAGG - Intergenic
1092987615 12:13861669-13861691 GAGCCTCAGCTTCCCTGGTGGGG + Intronic
1094629596 12:32159804-32159826 TTGCCATACCCTTCCTGGAGAGG + Intronic
1096773297 12:53949943-53949965 TTGCCAGAGCATCTCTGGAGAGG - Intergenic
1099100912 12:78439452-78439474 TAGCCACCACCAGCCTGGAGTGG - Intergenic
1100318086 12:93464261-93464283 TAGCAAGGGCCTCCCAGGAGTGG - Intergenic
1102416537 12:112767518-112767540 TAGCCAGACCCTCACTGGACTGG - Intronic
1103347265 12:120259614-120259636 CATCCAAGGCCTCCCTGGAGAGG + Intronic
1104730523 12:131103081-131103103 TAGCCACAACGTCCGTGGAGAGG + Intronic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1112264020 13:97906078-97906100 TTGCTAGAGCCTCCCAGGAGAGG - Intergenic
1113335324 13:109371233-109371255 TGGGCACAGCTTCCCTGGGGAGG - Intergenic
1113567904 13:111329798-111329820 AAGCCACAGCCCACCTGGAGCGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113730256 13:112636640-112636662 CATCCCCATCCTCCCTGGAGGGG - Intergenic
1118809237 14:69261274-69261296 GAGCCGCAGCCGCCCTGCAGGGG + Intronic
1118882824 14:69843301-69843323 AAGCCACAGACTCTCTGGAAAGG + Intergenic
1121629422 14:95411762-95411784 CAGGCACAGCCTCCCTGGGGGGG + Intronic
1123466093 15:20517095-20517117 TAACCACAGCCTTCATGGTGAGG - Intergenic
1123629399 15:22250836-22250858 GACCCACAGCCGCTCTGGAGGGG + Intergenic
1123652021 15:22483944-22483966 TAACCACAGCCTTCATGGTGAGG + Intergenic
1123742441 15:23292804-23292826 TAACCACAGCCTTCATGGTGAGG + Intergenic
1123760884 15:23431682-23431704 TAACCACAGCCTTCATGGTGAGG - Intergenic
1124276817 15:28333071-28333093 TAACCACAGCCTTCATGGTGAGG - Intergenic
1124305883 15:28578535-28578557 TAACCACAGCCTTCATGGTGAGG + Intergenic
1127274732 15:57432227-57432249 TAGCCACAGGGCCCCTGGAATGG + Intronic
1128141250 15:65302207-65302229 TAGCCCAGGCCTCCCTGGCGGGG - Intergenic
1129695580 15:77739059-77739081 GAGCCGCAGACTCCCTGGGGTGG - Intronic
1129772204 15:78209410-78209432 TTTCCACAACCTCCCTGGAGTGG - Intronic
1129823102 15:78617840-78617862 TGGACAAAGCCTCCCTGGGGAGG + Intronic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1132551625 16:556073-556095 TGGCCACAGCCTTCCCGGGGTGG + Intergenic
1132554444 16:566372-566394 TACCCAGAGGCTTCCTGGAGGGG + Intergenic
1132612356 16:823700-823722 TGGCCAAAGCCACCCTGGAAAGG - Intergenic
1133592841 16:7262894-7262916 AAGCCACAGCCTGTGTGGAGAGG + Intronic
1135195460 16:20390444-20390466 CAGGGACAGCCTCCCTGGAAAGG - Intronic
1135206821 16:20491865-20491887 TCCGCACAGCCTCCCTGCAGTGG - Intergenic
1135212064 16:20531767-20531789 TCCGCACAGCCTCCCTGCAGTGG + Intergenic
1136685365 16:31990964-31990986 TAGCCACAACCTCCCGTGAAAGG - Intergenic
1136785978 16:32934494-32934516 TAGCCACAACCTCCCGTGAAAGG - Intergenic
1136883796 16:33919309-33919331 TAGCCACAACCTCCCGTGAAAGG + Intergenic
1138563391 16:57815574-57815596 CACCCCCAGCCTCCCTGGTGAGG - Intronic
1139207678 16:65044959-65044981 GAGCTCCAGCCTCCCTGGTGGGG + Intronic
1139477577 16:67210337-67210359 TAGCCACAGCCTCTGTGGAGAGG + Exonic
1139563956 16:67761256-67761278 GCACCACAGCCTCACTGGAGAGG + Intronic
1141165196 16:81655617-81655639 TCGCCAAAGCCTTCCTGGAAAGG + Intronic
1141672160 16:85497857-85497879 TCCCCACAGCCTCCCTGGGAGGG + Intergenic
1142266821 16:89067792-89067814 AAGCCACACCTTCCCTGGGGGGG + Intergenic
1203088214 16_KI270728v1_random:1196152-1196174 TAGCCACAACCTCCCGTGAAAGG - Intergenic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1145216151 17:21054139-21054161 GCCCCACAGCCTCCCTGCAGAGG - Intergenic
1145779441 17:27552629-27552651 TTGCCCTAGCCTTCCTGGAGAGG - Intronic
1145785120 17:27588537-27588559 TAGGCACAGCGGGCCTGGAGGGG + Intronic
1145794735 17:27649129-27649151 TGGCTACAGCCACCCTGGAACGG + Exonic
1146295814 17:31649554-31649576 CCTCCCCAGCCTCCCTGGAGGGG + Intergenic
1147146310 17:38486639-38486661 TAGCCACAACCTCCCGTGAAAGG - Intronic
1147650343 17:42058442-42058464 TAGCCTCAGCCTCCCTGGAATGG + Intronic
1148385542 17:47232062-47232084 TAGCCTCAGCCTTGCTGGGGGGG + Intergenic
1148470520 17:47890216-47890238 TACCCCCAGTCTCCCTGGGGTGG - Intergenic
1148713735 17:49700554-49700576 TTAACCCAGCCTCCCTGGAGGGG + Intergenic
1149457709 17:56801740-56801762 TGGCCAAAGACTCCCTGGATAGG - Intronic
1149684618 17:58528204-58528226 TAGCCACAGTCTTCCTGCAAAGG + Intronic
1150261899 17:63800197-63800219 GTTCCACAGCCTTCCTGGAGTGG - Intronic
1151953652 17:77369790-77369812 CAGGCACAGCCTCCATGGAGAGG - Intronic
1152469625 17:80483441-80483463 TACCCACTGCCTCCCTGGATGGG - Intergenic
1152613855 17:81329070-81329092 AAGCCACAGCCTCCCTGCTCTGG + Intronic
1152921121 17:83067101-83067123 TTGCCACAGCCTTCCCTGAGAGG - Intergenic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1155564556 18:27119545-27119567 TAGCTAGAGACTCACTGGAGAGG - Intronic
1157413932 18:47486378-47486400 TAGCCGCAGGGTCCCTGCAGAGG - Intergenic
1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG + Intergenic
1160516142 18:79480266-79480288 TTGCCACAGCCTCTGTGGACTGG + Intronic
1160601936 18:80020368-80020390 TAGCCACAGACTTCCTTTAGAGG + Intronic
1160984975 19:1834308-1834330 TAGCACCTGCCTCCCAGGAGTGG + Intronic
1161924192 19:7289091-7289113 GAGACACAGCCTTCCAGGAGGGG + Intronic
1162324937 19:9993420-9993442 TGGCCAAAGTCACCCTGGAGAGG + Exonic
1162936387 19:13983649-13983671 AAGCCTGAGCCCCCCTGGAGGGG + Intronic
1163790253 19:19302206-19302228 TGGCCACAGTCCCCCTGCAGGGG - Intronic
1164461875 19:28455979-28456001 TGGTCACTGGCTCCCTGGAGGGG + Intergenic
1164643901 19:29844633-29844655 GAGCCACGGCCTCCCTGGGCGGG + Intergenic
1164669710 19:30065473-30065495 TTGCCCCAACCTTCCTGGAGAGG - Intergenic
1164899213 19:31904046-31904068 TAACACCAGCTTCCCTGGAGAGG + Intergenic
1165388410 19:35525004-35525026 CAGCCCCAGTCACCCTGGAGGGG - Intronic
1166748005 19:45151107-45151129 AAGCCACAGCCAGCCAGGAGGGG - Exonic
1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG + Exonic
1167221812 19:48204230-48204252 TTGCCACAGTAACCCTGGAGTGG + Intronic
1167239962 19:48337980-48338002 AAGCCAGAGTCTCCCTGGAGAGG + Intronic
1168233472 19:55047529-55047551 CTGCCACAGCCTCCCAGGTGAGG - Intronic
925187083 2:1855470-1855492 GAGCCGCAGCCTCCCTGAAAGGG - Intronic
925928989 2:8692682-8692704 TCGCCAAAGCCTCCCAGGGGAGG + Intergenic
926163786 2:10505525-10505547 CAGCCACAGGCACCCTGCAGGGG - Intergenic
926687477 2:15709294-15709316 TCGCCACTTCCTCCCTGGATAGG - Intronic
926801311 2:16663486-16663508 AAGGAACAGCCTCACTGGAGAGG + Intronic
927964569 2:27261332-27261354 AGGCCAGAGCTTCCCTGGAGGGG + Intronic
928470409 2:31569197-31569219 TAGCAGCAGCCTGACTGGAGTGG - Intronic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
933063374 2:77767244-77767266 CAGCCACAGCCTGTCTGGAATGG + Intergenic
934072607 2:88398351-88398373 TAGTCAAAGCCTCCTTGGTGTGG - Intergenic
934885973 2:98025301-98025323 TAGTCCCAGCTTCCCTGGGGTGG - Intergenic
937079563 2:119130678-119130700 TAGCAACAGACTCACAGGAGGGG - Intergenic
937863281 2:126729993-126730015 AAGCCACAGACTCCCTGGAACGG + Intergenic
937958652 2:127438183-127438205 TACCCACAGCCTCCCCGGCATGG - Intronic
938790106 2:134669033-134669055 TGGCCACATCCTCACTGCAGAGG + Intronic
938796782 2:134724425-134724447 GAGAGACAGCCTGCCTGGAGGGG + Intergenic
940904137 2:159153624-159153646 TGGCTACAGTCTGCCTGGAGAGG - Intronic
941933727 2:170967181-170967203 CAGCCACGTCCTCCCTGCAGGGG - Intergenic
941993570 2:171579891-171579913 CAGCCCCTGCCTCTCTGGAGTGG + Intergenic
942271786 2:174282685-174282707 GAGCCACAGCCTGCTTGGAGGGG - Intergenic
942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG + Intronic
947572193 2:231244914-231244936 TAGTCACCGCCTCTCTGGAGAGG + Intronic
947910730 2:233799237-233799259 CAGCCACATCCACCTTGGAGTGG + Intronic
1170638924 20:18134523-18134545 TGGCCACTGCTTTCCTGGAGAGG - Intergenic
1172010772 20:31844608-31844630 TAGCCGGAGCCTCCCTGGACAGG + Exonic
1172189690 20:33054482-33054504 TAAACATTGCCTCCCTGGAGAGG - Intergenic
1173181883 20:40812266-40812288 AGGCCACAGCATCCCTGGAGGGG + Intergenic
1173454935 20:43194332-43194354 TTGGCACAGCCTCCGTGGAACGG - Intergenic
1174362988 20:50040141-50040163 TAGCCTCAGCCTCCGGGGACAGG - Intergenic
1174689010 20:52484159-52484181 TAGTCACAGCTACTCTGGAGAGG + Intergenic
1175125139 20:56745660-56745682 AAGCCACAGCCTGCCTCGAGAGG + Intergenic
1176341149 21:5697189-5697211 TTGCCAGAACCTCCCTGGTGAGG - Intergenic
1176473403 21:7129342-7129364 TTGCCAGAACCTCCCTGGTGAGG - Intergenic
1176503678 21:7627267-7627289 TTGCCAGAACCTCCCTGGTGAGG + Intergenic
1176670728 21:9732898-9732920 CTGCCACAGCCTACCTGAAGGGG - Intergenic
1177154003 21:17483028-17483050 TTGCCACTGCCTCCCTGTATAGG - Intergenic
1177549147 21:22598097-22598119 TGGCCCGAGCCTCCCTGGATGGG + Intergenic
1179460377 21:41530748-41530770 TAATCACAGCCTCCCTGGCCAGG - Intronic
1180037390 21:45256800-45256822 CGGCCAGGGCCTCCCTGGAGGGG - Intergenic
1181581673 22:23832219-23832241 TTCTCACAGCCTCCCTGTAGTGG - Intronic
1182585292 22:31341385-31341407 TAGCCTGGGCCTCCCTGGAGAGG - Intronic
1183298562 22:37046625-37046647 AAGCCACAACCTCACTGGCGAGG - Intergenic
1184193454 22:42910438-42910460 AGGCCACAGCCTCTCTGGGGGGG + Intronic
1184285965 22:43471675-43471697 CAGCCTGAGCCTCACTGGAGAGG + Intronic
1184693492 22:46127860-46127882 TAGCCCCAGCCTGTCGGGAGAGG - Intergenic
1184819126 22:46895484-46895506 TTGCCTCAGCCTCCCTGGGCTGG + Intronic
1184889557 22:47371483-47371505 TAACAACAGGCTCTCTGGAGCGG + Intergenic
950721577 3:14886554-14886576 TTGCCACAGCCTCATCGGAGGGG - Intronic
950917970 3:16664879-16664901 GAGCCACAGCCTCTCTAGATTGG + Intronic
952339369 3:32432483-32432505 GAGCCACAGCCTCTATGGTGCGG + Intronic
952898898 3:38096835-38096857 TGGCCTCAGCCTCCATGCAGTGG - Intronic
953818427 3:46182942-46182964 CAGACACTGCCTCCCTTGAGTGG + Intronic
954316793 3:49805842-49805864 TAGCCCCAGCCTCCAGGGACTGG + Intronic
954752870 3:52823526-52823548 TGGCCAAAGCCACCCTGGAGGGG - Intronic
955359524 3:58261026-58261048 TGGCCACAGCATCCCCGGTGTGG - Intronic
956556834 3:70533782-70533804 TAGGCACAGCCTGGCTGGACTGG - Intergenic
957405286 3:79767447-79767469 CAGCCGCAGCCTACCTGGAACGG + Intronic
957429498 3:80083864-80083886 TGGTCACAGCCTCCCTTAAGAGG + Intergenic
959940414 3:112075360-112075382 GAGGCACAGACACCCTGGAGGGG + Exonic
961446454 3:126983676-126983698 TCTCCCCAGCCTCCGTGGAGGGG - Intergenic
961458377 3:127035378-127035400 TGGCCGGAGCCTCCCTGGAGTGG + Exonic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
961696642 3:128709724-128709746 TGCCCTCTGCCTCCCTGGAGAGG - Intergenic
964470277 3:157045658-157045680 CAGCCACATCCTCCCAGGGGTGG + Intronic
964970491 3:162553805-162553827 TAGCCCCAGCCACCATGGAGTGG - Intergenic
965264475 3:166523300-166523322 TTGACAGAGCCTCCCTGGAAAGG + Intergenic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
966942708 3:184757043-184757065 TAGCAACAGCCTGCCTGTGGGGG + Intergenic
968085128 3:195870752-195870774 TGGCCACAGCATGCCAGGAGTGG + Intronic
968502472 4:957329-957351 TTCCCACAGCCTCCCTGTGGAGG + Intronic
969531654 4:7733974-7733996 CTGCCACAGCCTCCTTGGTGTGG - Intronic
969690346 4:8700829-8700851 CAGCCACCCCCTCCCTGGTGGGG + Intergenic
969900742 4:10346903-10346925 TAGTCCTAGCCTCTCTGGAGTGG + Intergenic
973887442 4:55337377-55337399 TAGCCTCAGCCTCCCCAAAGTGG + Intergenic
978251134 4:106632598-106632620 AAGCCTCAGCCAACCTGGAGGGG - Intergenic
981178229 4:141707807-141707829 TAGCCACTGACTCTCTGGAGAGG - Intronic
982133084 4:152247744-152247766 GAGCCAGAGCCTCTCTGCAGAGG + Intergenic
985296503 4:188442616-188442638 TAGATGCAGCCTCACTGGAGGGG + Intergenic
985517294 5:353666-353688 AAGCCACAGGCCCCCTGGGGCGG - Intronic
985631257 5:1015255-1015277 TGCCCACAGCCTCCCTGGCGTGG + Intronic
986801367 5:11263865-11263887 TAGACACAGCGTCCCAGGTGTGG + Intronic
987402893 5:17496448-17496470 GGCCCACAGCCTCCATGGAGAGG - Intergenic
987409691 5:17602776-17602798 GGCCCACAGCCTCCGTGGAGAGG - Intergenic
987411585 5:17620539-17620561 GGCCCACAGCCTCCGTGGAGAGG - Intergenic
987877983 5:23705593-23705615 TAGCCTCAGCCTTCCTGCATCGG - Intergenic
988509787 5:31855262-31855284 TAGCCACAGCCTCGGAGGCGCGG + Intronic
988566032 5:32320616-32320638 GAGCCCCACCCTCCCAGGAGTGG - Intergenic
989139607 5:38189737-38189759 GAGCCACAGTCTCTCAGGAGAGG + Intergenic
989216484 5:38909316-38909338 TTTCCCCAGCCTCACTGGAGAGG + Intronic
991274253 5:64825065-64825087 TATCCACAGGCTACCTTGAGAGG - Intronic
991588860 5:68227691-68227713 TGGCCACAGCGATCCTGGAGAGG - Intronic
994043441 5:95284049-95284071 TCGCCCCAGCCTCCCCCGAGGGG - Exonic
997964829 5:138348646-138348668 TAGCCACCTCCTCTCTGGAGTGG - Exonic
999498618 5:152124816-152124838 TCGTCACAGGCTCCCTGGAGAGG - Intergenic
999753721 5:154648826-154648848 CAGCCCCAGCCACTCTGGAGGGG - Intergenic
1001426211 5:171624184-171624206 ATGCCACAGCCACCCTGGGGTGG + Intergenic
1001522235 5:172403018-172403040 TGGCCAGGGCCTCCCTGGTGAGG + Intronic
1001557911 5:172648806-172648828 AACCCACAGGCTGCCTGGAGAGG - Intronic
1001573736 5:172748346-172748368 TACCCACAGCCACCCTGGGAGGG - Intergenic
1001667942 5:173448939-173448961 AAGCCACTGGCTCCGTGGAGAGG + Intergenic
1001700856 5:173705666-173705688 TTGCCACGGGCTCCATGGAGTGG + Intergenic
1001824243 5:174732919-174732941 TTGCCACACACTCCTTGGAGAGG + Intergenic
1001978584 5:176021466-176021488 CAGGCACCACCTCCCTGGAGGGG - Intronic
1002238833 5:177822296-177822318 CAGGCACCACCTCCCTGGAGGGG + Intergenic
1002759232 6:189024-189046 TTGCCACAGCCTCTTTGGTGTGG + Intergenic
1003743871 6:8977382-8977404 TGTCAACAGACTCCCTGGAGAGG + Intergenic
1005448023 6:25945495-25945517 TGGTCACAGCCTCCCTTGAAAGG - Intergenic
1006419820 6:33925896-33925918 GCACCACAGCCTCCTTGGAGTGG - Intergenic
1009307118 6:62103748-62103770 CAGCAGCAGCCTGCCTGGAGGGG - Intronic
1011521287 6:88209467-88209489 TAGCCAGAGCATCCTTGCAGGGG + Intergenic
1013242641 6:108260652-108260674 CAGCCACAGCCTCCCAGGCCGGG - Intronic
1015960434 6:138643327-138643349 TATCCACATCCTCCATGGGGTGG + Intronic
1017679927 6:156853428-156853450 AAGCCACTGCCTCCCTGGAAAGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018683143 6:166281553-166281575 CAGCCCCAGCCTTTCTGGAGAGG + Intergenic
1018685278 6:166299131-166299153 TGGCCACAGCATTCATGGAGAGG - Intergenic
1018998190 6:168725987-168726009 CAGGCACAGGCTCCCCGGAGTGG + Intergenic
1024258741 7:47558644-47558666 TAACCACAGCCTCCCTGGGCAGG + Intronic
1026846200 7:73700350-73700372 CAGCCAGGGCCTCCTTGGAGTGG + Exonic
1029193631 7:98789107-98789129 AAGCCAGAGAGTCCCTGGAGAGG - Intergenic
1029443873 7:100602467-100602489 CAGCCACAGCCTCCCTCCTGGGG + Exonic
1029706896 7:102280876-102280898 TACCCACCCCCTCCCTGGACAGG + Intronic
1031915661 7:127560457-127560479 TAACCACTGCCTCTCTGGAATGG - Intergenic
1032454914 7:132065905-132065927 AAAGCACAGCCTGCCTGGAGAGG - Intergenic
1032489020 7:132309967-132309989 TAGGCACCGCCACCCTAGAGTGG + Intronic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035005322 7:155653561-155653583 AACCCCCAGCCTCCCTCGAGGGG + Intronic
1035062401 7:156079321-156079343 TTCCCACAGGCTCCCTGGATGGG + Intergenic
1035198736 7:157245693-157245715 CAGCCGCAGTCTTCCTGGAGGGG + Intronic
1035790014 8:2296030-2296052 CAGCCACAGCCAGCCTGGATGGG + Intergenic
1035802791 8:2425675-2425697 CAGCCACAGCCAGCCTGGATGGG - Intergenic
1036123419 8:6041946-6041968 TAGAAAAAGCCTCTCTGGAGGGG + Intergenic
1036416111 8:8550184-8550206 TCCCCACATCCTCCCTGAAGTGG - Intergenic
1037919295 8:22792890-22792912 AAACCACAGACTCCTTGGAGTGG + Intronic
1038428236 8:27479281-27479303 CACACACAGCCTCTCTGGAGGGG + Exonic
1038627648 8:29209582-29209604 TAGTCACACCCTGCCTGGAGAGG - Intronic
1039399844 8:37260566-37260588 TAATCTCTGCCTCCCTGGAGAGG + Intergenic
1039412072 8:37363242-37363264 TGGGCCCTGCCTCCCTGGAGAGG - Intergenic
1040605185 8:48924414-48924436 TCCCCACAGGCTCCCTGGATGGG + Intergenic
1040947133 8:52895276-52895298 TACTCACAGCCGCCCCGGAGTGG - Intergenic
1041101004 8:54396394-54396416 TCACCACATCCTCCCTGCAGGGG - Intergenic
1041586704 8:59529128-59529150 TAGCTCCAGCCTCCTTGGATAGG - Intergenic
1043594061 8:81863877-81863899 GAGCCAGAGCCTCCCAGAAGAGG - Intergenic
1043735168 8:83731597-83731619 CAGCAGCAGCCTGCCTGGAGCGG - Intergenic
1044016030 8:87049773-87049795 TAGCCAGAGACTCCCTTTAGAGG + Intronic
1045278531 8:100728408-100728430 TTGCCTCAGCCTCCCAGTAGTGG - Intergenic
1047764058 8:127976002-127976024 TAGCCTCAGCCTTCCTACAGAGG - Intergenic
1048315145 8:133356229-133356251 GAGCCACAGCCTCCCGGGACAGG - Intergenic
1051161009 9:14207381-14207403 TGGCAAAAGCCTCCCTTGAGTGG + Intronic
1053446952 9:38159892-38159914 CAGGCACAGCCACCCTTGAGAGG - Intergenic
1058854318 9:109045225-109045247 CAGCCCCAACCTCCCTTGAGAGG + Intronic
1058973194 9:110101671-110101693 TTCCCACGGCCTCTCTGGAGGGG + Intronic
1059311613 9:113392123-113392145 TATCACCAGCCTCCCAGGAGTGG - Exonic
1059539351 9:115115259-115115281 TGGCCACAGTCTGCCTGGAGGGG + Intronic
1060802080 9:126551233-126551255 TGGCCGCAGCCTTCCTGCAGAGG + Intergenic
1060812722 9:126619071-126619093 TAGGCACATCCTACCTGGACAGG - Intronic
1061848656 9:133402169-133402191 GAGCCCCAGCCTCCCAGAAGGGG - Intronic
1062276826 9:135735349-135735371 GTGCCTCAGCCTCCCTCGAGTGG + Intronic
1203421918 Un_GL000195v1:804-826 TTGCCAGAACCTCCCTGGTGAGG + Intergenic
1187648459 X:21374787-21374809 TGGCCGCAGCCTCCCTGGGCGGG - Intronic
1188446359 X:30256829-30256851 TAGCCCTAGCCTCAGTGGAGAGG - Intergenic
1199221099 X:145316406-145316428 TAGCCCCAGCCTCTATAGAGGGG + Intergenic