ID: 1132504809

View in Genome Browser
Species Human (GRCh38)
Location 16:302459-302481
Sequence GATGGTGGAGCTCCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132504809_1132504812 -5 Left 1132504809 16:302459-302481 CCTTCATGGGGAGCTCCACCATC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1132504812 16:302477-302499 CCATCTGCAGCGACCACACCTGG 0: 1
1: 0
2: 2
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132504809 Original CRISPR GATGGTGGAGCTCCCCATGA AGG (reversed) Intronic
900343639 1:2200535-2200557 GAGGGTGGAGCTCCGCCTAAAGG - Intronic
900845628 1:5098070-5098092 GAGGGTGGAGCACCCCAGAAAGG - Intergenic
901573288 1:10179467-10179489 GATGATGGAGCGGTCCATGATGG - Exonic
901920346 1:12531701-12531723 GCTGGTGGGGCTACCCAGGAGGG - Intergenic
902243601 1:15104257-15104279 GATGGTCCAGCTCCCCATCCTGG + Intronic
911229378 1:95344600-95344622 AAGGGTGGATTTCCCCATGATGG + Intergenic
911923117 1:103792589-103792611 GATAGAGGAGCTCCACGTGAGGG + Intergenic
912678845 1:111715054-111715076 GATGTTGAAGCTCCCCCTGGTGG - Exonic
916007302 1:160674283-160674305 GATGTTCCAGCTGCCCATGAGGG - Intergenic
917677276 1:177331687-177331709 GATAGTGCAGGTCCCCCTGAAGG + Intergenic
919838797 1:201594509-201594531 GGTGGCAGAGCTCCCCATGCAGG + Intergenic
920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG + Intergenic
920800985 1:209187159-209187181 GAAGGTGGAGGTCTCCATCATGG + Intergenic
922673860 1:227538290-227538312 CAGGGTGGGGCTGCCCATGATGG + Intergenic
922707071 1:227795451-227795473 GTTGGGGGAGCTCCCCTGGAAGG - Intergenic
922956215 1:229602978-229603000 GATGGTGGTGATCCCCAGGAGGG - Intronic
923435536 1:233964450-233964472 CATGGAGGACCTCACCATGAGGG + Intronic
924894774 1:248324434-248324456 CATGATGGAGTTTCCCATGAAGG + Exonic
1063360530 10:5452468-5452490 GATGCTGGACATCACCATGAAGG + Exonic
1064983237 10:21185080-21185102 GATGGTGGCCCTTCCCATAATGG + Intergenic
1067221380 10:44346620-44346642 GATGCTGGAGCCCTTCATGAAGG + Intergenic
1068856582 10:61804047-61804069 GATGGTGGTGATGACCATGATGG + Intergenic
1069502361 10:68965467-68965489 TATGGTGGAACTCCCTATGGAGG + Exonic
1071461394 10:85900161-85900183 CCTGGTGGAGCTCCCCAGGAAGG - Intronic
1075920807 10:126211181-126211203 GAAGGTGGAGCTTCCCTTCAGGG + Intronic
1077739722 11:4832251-4832273 GATGGTGCAGTTGCCCAGGATGG - Intronic
1077746080 11:4907482-4907504 AATGGTGCAGTTGCCCATGATGG - Exonic
1077789395 11:5422319-5422341 GATGGTGGTATTGCCCATGATGG - Exonic
1077868263 11:6240555-6240577 GATGGTGGCGAAACCCATGACGG - Exonic
1085315895 11:75544787-75544809 GATGGTCTAACTCCCCATGGAGG - Intergenic
1089183557 11:116599229-116599251 GATGCTGGAGCTCCCCACTGAGG - Intergenic
1096858423 12:54503825-54503847 GATGGGGGATCTCACCATGTTGG + Intronic
1097042571 12:56164504-56164526 GATGGTGGTGATGCCCATGCAGG + Exonic
1098353306 12:69585688-69585710 GCCGGTGGAGCTCACCACGAGGG + Intronic
1098595984 12:72273245-72273267 GAAGGTGAAGTTCTCCATGAAGG - Exonic
1101740608 12:107497117-107497139 GATGGTGGAGGTAACGATGATGG - Intronic
1101940567 12:109096796-109096818 GATGGGGGATCTCACCATGTTGG - Intergenic
1103009196 12:117444961-117444983 GTTTGTGGAGGTCCCCTTGAGGG + Intronic
1105013700 12:132773245-132773267 GATGGAGGAGCACGCCCTGACGG - Exonic
1106369057 13:29113743-29113765 TGTGGTGCAGCTCCACATGAAGG - Intronic
1112045191 13:95589573-95589595 GATGGTGGAGATACCTCTGAAGG - Intronic
1119634475 14:76262848-76262870 CATGGGGGAATTCCCCATGATGG + Intergenic
1120394653 14:83953976-83953998 GAGGGTGGAGCCCCCCAAAATGG + Intergenic
1121724987 14:96140659-96140681 GATGATGAAGCTCACCTTGAAGG + Intergenic
1122047386 14:99033977-99033999 GATGATGAAGGTCCCCAAGAAGG - Intergenic
1122397038 14:101441231-101441253 GGTGGTGCCGCTCCCCATGGGGG + Intergenic
1131228480 15:90644025-90644047 GGTGGAGGGGCACCCCATGAGGG - Intronic
1132504809 16:302459-302481 GATGGTGGAGCTCCCCATGAAGG - Intronic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1137275465 16:46930294-46930316 GATGGGGAAGCTCCCAGTGAGGG - Exonic
1139150855 16:64380930-64380952 GAGGGCGGGGCTCCCCCTGACGG - Intergenic
1139358285 16:66380478-66380500 GATGGTGGTGATCACGATGATGG + Intronic
1139761398 16:69187244-69187266 GCTGGTGGAGCTGCTCCTGAGGG + Exonic
1143266106 17:5639258-5639280 GATTCTGGATCTCTCCATGAAGG - Intergenic
1143992823 17:10981119-10981141 GAGGATGGAGAGCCCCATGAGGG - Intergenic
1144745168 17:17609176-17609198 GATGGTGGTGCCTCCCAGGAGGG + Intergenic
1144838924 17:18173786-18173808 GATGGTGAAGTTCCCCCTGAAGG + Exonic
1145289823 17:21534322-21534344 GATGCTGGAGCCCTCCATGCTGG - Exonic
1146514197 17:33476247-33476269 GATGGTGGAGGTCGCAGTGATGG - Intronic
1148109540 17:45136869-45136891 GAAGGTGGTGATTCCCATGAGGG - Intronic
1149443921 17:56699103-56699125 GAAGGTGGAACTCCCCAAGTAGG - Intergenic
1149630449 17:58117527-58117549 GATGGTGATGCTGCCGATGATGG + Intergenic
1152057581 17:78042712-78042734 GATGGTGGAGATAACAATGATGG + Intronic
1152928288 17:83097862-83097884 GGTTGGGGAGCTCCACATGAAGG + Intergenic
1153407739 18:4759446-4759468 GATGGTGCAGGTCCCCACAAAGG + Intergenic
1153815091 18:8784510-8784532 GACGGTGGAGCGCCTCATCACGG + Exonic
1159666256 18:71163821-71163843 GATGCTGGTGCTCCCCAGGTGGG - Intergenic
1160930969 19:1569160-1569182 GAGGGTGGGGCTCCACATGGAGG - Intergenic
1160968957 19:1759036-1759058 GATGGTGGAGCCCAGCATGGAGG + Intronic
1162824433 19:13243042-13243064 GATGGTCCAGCTCCCCAGAAGGG - Intronic
1163040093 19:14595703-14595725 GATGGTGGAGATACTGATGATGG + Intronic
1163703581 19:18799344-18799366 GATGGTGGAGCTCAGTCTGATGG - Intergenic
1165026862 19:32968715-32968737 GAGAGTGGTGCTGCCCATGAGGG - Intronic
1167228897 19:48269171-48269193 GCTCCTGGAGCTCCCCAGGAAGG - Intronic
1167376741 19:49116310-49116332 GGTAGTGGAGCTACCCAAGACGG + Exonic
1167757595 19:51422095-51422117 GAAGGTGGAGCGCCCCCTGGGGG - Intergenic
1168322742 19:55519703-55519725 GATGGTGGTGCTGGTCATGAGGG + Intergenic
927743096 2:25590156-25590178 GATGTAGGAGCTCCCCAGGCCGG - Intronic
930211798 2:48646910-48646932 GCTGGTGGAGAGCCCCATGAGGG - Exonic
930566651 2:53028928-53028950 GAGGATGGAGTTACCCATGATGG + Intergenic
932430342 2:71670368-71670390 CATGGGGGAGCTTCCCAAGAAGG + Intronic
934500781 2:94858488-94858510 GAAGGTGGAGCTCCCCTGGATGG + Intergenic
938119884 2:128625887-128625909 GATGGTGCATCTCCCAATGGTGG - Intergenic
948772092 2:240256773-240256795 GATGGTGGAGCAGCACATGGAGG - Intergenic
1171891997 20:30725205-30725227 GAAGGCGGAGCTCCCCTGGATGG + Intergenic
1174406651 20:50307150-50307172 GATCCTGGAGCTCCTCATGGTGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176625183 21:9086769-9086791 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1177681472 21:24376848-24376870 GGTGGTTTAGCTCCCCCTGAAGG - Intergenic
1178462584 21:32816511-32816533 GAGGTAGTAGCTCCCCATGATGG + Intergenic
1179188654 21:39105144-39105166 GCGGGTGGAGCCCCCCATGGTGG - Intergenic
1181034189 22:20162081-20162103 GCTGGTGGAGCTGACCATGATGG - Intergenic
1181045055 22:20210503-20210525 GTGGGTGGTGCTCACCATGATGG - Intergenic
1181509163 22:23381320-23381342 GCTGGTGGAGCTGGCCATGATGG + Intergenic
1181778918 22:25178860-25178882 GAGGAAGGGGCTCCCCATGAGGG - Intronic
1182043304 22:27255043-27255065 AATCTTGGAGCTCCCCATGAAGG + Intergenic
1182187115 22:28416624-28416646 GTTGGTGGAGCTCACCCTAATGG - Intronic
1183073226 22:35410782-35410804 GATGGAGTAGATGCCCATGATGG - Exonic
1184519747 22:44986379-44986401 GATGGTGGTGCTCCTGGTGATGG - Intronic
1184653310 22:45929124-45929146 GATGGTGGTGGTTCCCACGAGGG + Intronic
950860336 3:16142216-16142238 GAAGATGGAGCTTCCCAGGATGG - Intergenic
953421531 3:42757052-42757074 AATGGTGGAGCTACCTGTGAAGG + Exonic
953989401 3:47472681-47472703 GATGGTGGAACTCAGCAAGAAGG - Intronic
956223530 3:66930328-66930350 GATGGTGGAGCTAAAGATGAAGG + Intergenic
956718562 3:72099058-72099080 GAATGTGGAGCTCCCCATGCAGG - Intergenic
960173434 3:114490080-114490102 GATGGTGTAGATCACCATTAGGG + Intronic
961166075 3:124764808-124764830 GATGTGGGTGCTGCCCATGAGGG - Intronic
965783706 3:172314755-172314777 TAAGGTGGATCTTCCCATGAAGG - Intronic
967478303 3:189946025-189946047 CATGGCGGACCTCCCCAGGAAGG + Intergenic
968069824 3:195777973-195777995 GATGGAGGAGCACCCCAGGCAGG - Intronic
971703281 4:30007862-30007884 AATGGTGGTGATCCCAATGAAGG - Intergenic
976070447 4:81234203-81234225 AATGGTGGTGCTACCCATCAGGG - Intergenic
976660137 4:87532364-87532386 AATAGTGGAGATCCCCAGGAAGG + Intergenic
977311631 4:95395081-95395103 TATGGTGGAGCTCTCCATGGTGG + Intronic
982202629 4:152974949-152974971 GCCGGTGGAGCTCTCCAAGAAGG - Exonic
983115585 4:163812112-163812134 GATGGTGTAGATCCCCACCAGGG - Intronic
985285746 4:188335093-188335115 GATGGGGGAGCTCCTGCTGATGG + Intergenic
985487138 5:158207-158229 GATGGGGGAGACCCCCAGGATGG - Intronic
985487157 5:158248-158270 GATGGAGGAGACCCCCAGGATGG - Intronic
985487170 5:158288-158310 GATGGAGGAGACCCCCAGGATGG - Intronic
985487183 5:158328-158350 GATGGAGGAGACCCCCAGGATGG - Intronic
985487196 5:158368-158390 GATGGAGGAGACCCCCAGGATGG - Intronic
985761460 5:1751388-1751410 GGGGGTGGAGGTCCCCATGGAGG - Intergenic
985761501 5:1751498-1751520 GAGGGCGGAGTTCCCCATGGAGG - Intergenic
986227526 5:5829397-5829419 GATGATGGAGCTCTGCATCAAGG + Intergenic
986874331 5:12088881-12088903 GAAGGTGGGGCCCCCTATGATGG - Intergenic
988422960 5:31028874-31028896 GATGGTGGGGACCTCCATGATGG - Intergenic
992408753 5:76484444-76484466 GATGGGGGAACACCCCATAAAGG - Intronic
997032070 5:130141892-130141914 GATGGTGGAGCTCCCTCTGCTGG + Intronic
998871674 5:146558634-146558656 CAGGGTGGAGCTCCCCATTATGG + Intergenic
1001932609 5:175683946-175683968 GATGATGAAGGCCCCCATGACGG - Exonic
1002201526 5:177531428-177531450 GAAAGAGGAGCTGCCCATGAAGG - Intronic
1002638305 5:180618863-180618885 CATGGTGGAGCTCGCCAGGCTGG - Exonic
1006133998 6:31884749-31884771 GATGGCGGCGCTGCCCGTGAAGG + Exonic
1007083710 6:39127738-39127760 CATGGTGGAGGGCCCCATGGTGG + Intergenic
1007164532 6:39819854-39819876 GAGGGTGGAGCTCCCCTGAACGG - Intronic
1011859727 6:91739600-91739622 GATGGAGGAGCTAGGCATGATGG + Intergenic
1012975951 6:105781117-105781139 CATGGTGGGGCTCCCCATGCCGG + Intergenic
1013943860 6:115698660-115698682 GATGATGGAGCTTCCTATTATGG + Intergenic
1021433546 7:20588753-20588775 GACGGTGGATCTCCCCAGGGCGG + Intergenic
1022464846 7:30646758-30646780 GCTGGTGGGGTTCCCCATAAAGG - Intergenic
1023816319 7:43953029-43953051 AATGGTGCTGCTGCCCATGATGG + Exonic
1029358606 7:100071587-100071609 GAGGGTGGAGCTCCAGCTGAAGG + Exonic
1032839021 7:135699390-135699412 GCTGGTGGAGGTGCCGATGATGG + Exonic
1033619864 7:143052447-143052469 GATGATGGTGTTTCCCATGAAGG - Exonic
1035192806 7:157186986-157187008 GATGGTGCAGCACCGCATGATGG + Exonic
1035199119 7:157248809-157248831 GAGAGTGGAGCTCCGCAGGAGGG - Intronic
1035326689 7:158070540-158070562 GGTGGTGGAGGTGCCCATGGTGG + Intronic
1035326718 7:158070630-158070652 GGTGGTGGAGGTGCCCATGGTGG + Intronic
1035326778 7:158070824-158070846 GGTGGTGGAGGTGCCCATGGTGG + Intronic
1038199154 8:25395688-25395710 GTTGGAGAAGCCCCCCATGACGG - Exonic
1039567883 8:38564328-38564350 CATGGGGGAGCACCCCAGGAAGG - Intergenic
1039612881 8:38933005-38933027 GAGGGTGGAGCAGCCCTTGAGGG + Intronic
1039804060 8:40983802-40983824 GAGAGTGGAGCTGCCCAAGAAGG - Intergenic
1040891846 8:52325171-52325193 AATGGTGGAGCTGCTGATGAGGG + Intronic
1044711731 8:95065014-95065036 GAGGGTGGAGCTCCCAGGGAGGG + Intronic
1046305348 8:112358047-112358069 GAGGGTGGAGCTTCCTAAGAGGG + Intronic
1047934766 8:129765964-129765986 GATAGAGGAGATCCCAATGATGG + Intronic
1049958047 9:711464-711486 GCGGATGGAGCTCCCCATGGAGG - Exonic
1050329426 9:4530667-4530689 GATGGTGGAGTCACCCATGACGG + Intronic
1053656400 9:40222053-40222075 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1053906750 9:42851271-42851293 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1054368506 9:64368275-64368297 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1054528216 9:66154232-66154254 GAAGGCGGAGCTCCCCTGGATGG + Intergenic
1054676130 9:67858027-67858049 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1056389765 9:86130246-86130268 GAAGGAGGAGCTTCACATGACGG - Intergenic
1061567152 9:131448631-131448653 GAGGCTGCAGCTCACCATGATGG - Intronic
1061793196 9:133069293-133069315 GAAGGTGCAGCACCCCAGGAAGG - Intronic
1061795800 9:133085077-133085099 GAAGGTGCAGCACCCCAGGAAGG - Intronic
1062018715 9:134305616-134305638 GATGGTGGTGATCACCATGTTGG + Intergenic
1203748357 Un_GL000218v1:57229-57251 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1188283108 X:28294897-28294919 GAAGGTGGATCCCCTCATGATGG - Intergenic
1200735389 Y:6788404-6788426 GATGATGCGGCTCCCCGTGACGG + Intergenic
1201143536 Y:11048184-11048206 GATGGTGGTGATCATCATGATGG + Intergenic
1201161704 Y:11172199-11172221 GAAGGCGGAGCTCCCCTGGATGG - Intergenic