ID: 1132504824

View in Genome Browser
Species Human (GRCh38)
Location 16:302547-302569
Sequence TGCCATCTCAATGGAGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132504818_1132504824 18 Left 1132504818 16:302506-302528 CCATGAATCCCAGCTGCTCAACG 0: 1
1: 1
2: 1
3: 38
4: 979
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108
1132504820_1132504824 9 Left 1132504820 16:302515-302537 CCAGCTGCTCAACGAGCTATGTA 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108
1132504816_1132504824 22 Left 1132504816 16:302502-302524 CCCGCCATGAATCCCAGCTGCTC 0: 1
1: 0
2: 3
3: 71
4: 1287
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108
1132504817_1132504824 21 Left 1132504817 16:302503-302525 CCGCCATGAATCCCAGCTGCTCA 0: 1
1: 0
2: 1
3: 46
4: 782
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108
1132504814_1132504824 29 Left 1132504814 16:302495-302517 CCTGGTCCCCGCCATGAATCCCA 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108
1132504815_1132504824 23 Left 1132504815 16:302501-302523 CCCCGCCATGAATCCCAGCTGCT 0: 1
1: 0
2: 3
3: 20
4: 450
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108
1132504819_1132504824 10 Left 1132504819 16:302514-302536 CCCAGCTGCTCAACGAGCTATGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132504824 Original CRISPR TGCCATCTCAATGGAGTGCC CGG Intronic
901648386 1:10728797-10728819 TGGCTTTTTAATGGAGTGCCTGG + Intronic
907731369 1:57069752-57069774 TGCTATCTCACTGGAATGCCTGG + Intronic
915493742 1:156266544-156266566 TGCCATCACTCTGGAATGCCGGG + Exonic
918151328 1:181799974-181799996 TGCCCTCTCAGAGGAGTGGCAGG - Intronic
920349609 1:205329202-205329224 TGCCCCCTCAATGGTGTACCTGG - Intergenic
1062867292 10:866417-866439 TGCCAGCTCAGTGCCGTGCCTGG - Intronic
1068269089 10:54696433-54696455 TGTCATTTCAATGGAGTTCATGG - Intronic
1072625197 10:97106845-97106867 TGCCAGCTCAAGGGACTGACAGG + Intronic
1074186182 10:111101169-111101191 TTCCAGCTCCATGGGGTGCCGGG - Intergenic
1077865370 11:6217667-6217689 CCCCAGCTCAATGGAGTGCCAGG - Exonic
1077967622 11:7152811-7152833 GGCCATGTCAGTGGAGTCCCTGG + Intergenic
1078669074 11:13348970-13348992 TGCCATCTCAAGGCAGTGCAGGG + Intronic
1079185511 11:18232359-18232381 TGGCCTCTCACTGGAGTCCCCGG + Intronic
1083321761 11:61852052-61852074 TGCCACCTCATGGGGGTGCCGGG - Intronic
1084117999 11:67053011-67053033 TGCCATCTAACTGGAGCCCCAGG - Intergenic
1085403798 11:76249904-76249926 TGCCAACTCAGTAGAGTGCGGGG - Intergenic
1085699953 11:78737070-78737092 TGCCATCTCACAGGAGTGACTGG + Intronic
1086086065 11:82956394-82956416 TTCCATCTCACTGGTGTTCCAGG + Intronic
1087731730 11:101786017-101786039 TTCCATCTCAATGGTCTGTCTGG + Intronic
1091297318 11:134483087-134483109 TGCATTCCCAAGGGAGTGCCTGG + Intergenic
1091457094 12:616135-616157 TGCCATTTCAACGGGTTGCCTGG + Intronic
1091690103 12:2590032-2590054 TACCAGCTGAAGGGAGTGCCTGG - Intronic
1091912905 12:4246013-4246035 TGCCCTTTCAAAGCAGTGCCGGG - Intergenic
1096316411 12:50571086-50571108 TGCCATCGCAATGTAGTGGAGGG + Intronic
1100406221 12:94274987-94275009 TCCTATCTCAAAGGAGTGACAGG - Intronic
1100802012 12:98241903-98241925 TACCATCCCAATGGAGTGGGAGG - Intergenic
1102382710 12:112481267-112481289 TGCCTTCCCTATGGAGTGACTGG + Intronic
1102590656 12:113954494-113954516 TGCTACCCCAATGGGGTGCCAGG - Intronic
1109624583 13:64958348-64958370 TGACTTCTCAATGAGGTGCCTGG + Intergenic
1113794540 13:113049392-113049414 TGCCCTCTCCAAGGAGTGCGTGG - Intronic
1117252290 14:53950100-53950122 TGCCATCTCCATGCTGTACCTGG - Exonic
1118055081 14:62071215-62071237 TGCCCTCTCAATGGAGAGAAAGG - Intronic
1118059997 14:62125854-62125876 TGCCATATCAATAGAATGCCAGG - Intergenic
1119775381 14:77244784-77244806 TGCCTTCTGCATGGAATGCCTGG - Intronic
1121282143 14:92706630-92706652 TGACTTCTCAATGAGGTGCCTGG + Exonic
1127732815 15:61816018-61816040 TACCATCTTAATGGGTTGCCAGG - Intergenic
1130557138 15:84930563-84930585 TACCATCTCAGGGAAGTGCCAGG - Intronic
1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG + Intronic
1134559116 16:15192551-15192573 TGCATTCTCAATTCAGTGCCTGG - Intergenic
1134919652 16:18104164-18104186 TGCATTCTCAATTCAGTGCCTGG - Intergenic
1137432813 16:48432346-48432368 TGCTGCCTCAATGGAGTGCAGGG + Intronic
1138170760 16:54847294-54847316 TGACTTCTCCATGGAGAGCCAGG - Intergenic
1144153340 17:12472645-12472667 ACCCTTCACAATGGAGTGCCTGG + Intergenic
1147511279 17:41070996-41071018 TTCCATTTTAATGGAGTGTCCGG + Intergenic
1152133440 17:78490890-78490912 TGCCATCCCAATGGTGTTCTGGG + Intronic
1153055336 18:940153-940175 TGCCATTTAAATGGGGTTCCTGG + Intergenic
1159909219 18:74128380-74128402 TGCCATCTCTATGGAGGGACAGG - Intronic
1166312433 19:41970281-41970303 TGCCATCTCACTGGCGTACGAGG - Exonic
1167436204 19:49480310-49480332 TGCCACCCCCATGGAGTCCCCGG + Exonic
1167595089 19:50423275-50423297 TGCAGTCTCAATGCAGTGCCCGG - Intronic
926613980 2:14976482-14976504 TGGGATCTCAATTGAATGCCTGG - Intergenic
934753480 2:96809508-96809530 TGCCATCTGACAGGAGGGCCCGG + Exonic
938614920 2:132987772-132987794 TGCCATAAAAATGGAGTGCTTGG - Intronic
943964949 2:194320872-194320894 TGCCACCTCAATAAAGTTCCTGG - Intergenic
946495459 2:220191919-220191941 TGCCAGCTCCATGGAGTGCACGG - Intergenic
1169587679 20:7104240-7104262 AGGCATCTCCATGGAGTGCAGGG - Intergenic
1169790385 20:9403929-9403951 AGACATTTCAGTGGAGTGCCAGG + Intronic
1170837290 20:19895210-19895232 TGTAGTCTCAATGCAGTGCCAGG + Intronic
1175914687 20:62420097-62420119 TGGCACCTCAATGGAGGGACAGG + Intronic
1179843122 21:44090446-44090468 TGGCATCTCATGGGAGAGCCTGG - Intronic
1182072949 22:27476215-27476237 TTCCAACACAATGAAGTGCCAGG - Intergenic
1184397027 22:44248434-44248456 TGCCATCTCATAGGTGTCCCAGG + Exonic
951750129 3:26025601-26025623 TGCTTTCTCAATGGAGAGGCTGG - Intergenic
965087130 3:164113688-164113710 TGCCTTCTCCATGGAGTGGGAGG - Intergenic
966610434 3:181862675-181862697 TGCCATCTCAATTGAGATCTGGG - Intergenic
967274154 3:187757352-187757374 AGCCCTCTCATTGGAGAGCCTGG + Intergenic
967873957 3:194253659-194253681 TGCCATCTTTATGGAGGGCGGGG - Intergenic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
969091439 4:4696762-4696784 TGCCAGCACAATGGCGTTCCGGG - Intergenic
970120416 4:12747006-12747028 AGCCATCTCACTGGAGAGGCAGG + Intergenic
970679341 4:18489297-18489319 TTCCATCTCACTGGGGTTCCAGG - Intergenic
974476536 4:62388779-62388801 TGCCATCTCAAAGAAGTGATAGG - Intergenic
974723460 4:65771502-65771524 TTTCATCTCAGAGGAGTGCCCGG + Intergenic
976129547 4:81870426-81870448 TGCCAGCTCCATGGAGTGAACGG - Intronic
979022896 4:115525294-115525316 TGCTGTCTCACTGGAGTACCAGG + Intergenic
979097694 4:116572350-116572372 TGCTATCTCAATGAAGTTTCTGG - Intergenic
979987987 4:127339001-127339023 GCCTATCTCAATGGATTGCCTGG + Intergenic
983958320 4:173722684-173722706 TGGGATCTCAATGGAACGCCTGG - Intergenic
986708916 5:10473419-10473441 TGCCATCACTAAGGAGTGCTTGG + Intergenic
987427481 5:17789956-17789978 TGCCATGTGGATGGAGTGCGAGG + Intergenic
993980734 5:94540475-94540497 TGCCATCACAATGGTGGCCCAGG + Intronic
994099901 5:95880876-95880898 AGCCTTGTCAAAGGAGTGCCAGG - Intergenic
994115440 5:96056875-96056897 TACCATCCCCAAGGAGTGCCTGG + Intergenic
999176675 5:149636663-149636685 GGCCATCTCAAGGGTGTGGCAGG + Intergenic
1000961524 5:167606536-167606558 TGCCATCACATTGGAGGGCTAGG + Intronic
1001192968 5:169647609-169647631 GGCCATCTTAATGGAGTCCCAGG - Intronic
1001797824 5:174516811-174516833 TCCCATCTGAATGGAGTGGTTGG + Intergenic
1002275150 5:178099562-178099584 TGCCAGCTCAGTGCAATGCCAGG + Intergenic
1003867030 6:10372597-10372619 TGCCATCACAAATGAGTGCATGG + Intergenic
1006749780 6:36369551-36369573 TGCCCTCCCAATGGCATGCCTGG - Intronic
1007562310 6:42820097-42820119 TAACACCTCAATGGAGTGACTGG + Intronic
1010823276 6:80441808-80441830 TATCATCTAAATGCAGTGCCTGG - Intergenic
1011702684 6:89970236-89970258 TGCCACCTCAAGGTAGGGCCTGG + Intronic
1011948703 6:92937646-92937668 AGACATCTCCATGGAGTCCCTGG + Intergenic
1012955581 6:105566238-105566260 AGCCATCTCACTGGAGTGGAAGG + Intergenic
1013895173 6:115079379-115079401 TGCTTTCTCACTGGAGTGCTGGG - Intergenic
1014993294 6:128108980-128109002 TGCCATCTCAATGGAGTAGAGGG + Intronic
1015455762 6:133424675-133424697 TGCCTTCTCCATGGAGTGGGAGG + Intronic
1017498405 6:155001610-155001632 TTCCAGCTCGATGGAATGCCTGG - Intronic
1020557664 7:9690916-9690938 TCCCATTTCACTGGAGTTCCAGG - Intergenic
1022278961 7:28886053-28886075 TTCCAGCTCAATGGAGTACCTGG + Intergenic
1023559988 7:41463773-41463795 TACCATATGAATGCAGTGCCTGG - Intergenic
1023892418 7:44402767-44402789 TGCCATCTCCATGGACTGAGAGG - Intronic
1026178317 7:68016977-68016999 TGCCAGCACAATAAAGTGCCTGG - Intergenic
1030590725 7:111478094-111478116 TACCATCTAATTGGAGTCCCAGG - Intronic
1031077020 7:117222776-117222798 TGAAATCTGAATGGAGTTCCAGG - Intronic
1031321888 7:120340511-120340533 TGACATCTCAATGAAATGTCAGG + Intronic
1031535470 7:122928595-122928617 TGCCACCTCAATGAAGTTCCTGG + Intergenic
1034893573 7:154860577-154860599 TGCCATCTCAATCCAGTCCAGGG + Intronic
1036644648 8:10604525-10604547 TGCCATTTTAATGAGGTGCCAGG + Intergenic
1038398182 8:27262322-27262344 TGCCATCTCAGGGAAGTCCCAGG - Intergenic
1039422390 8:37453924-37453946 TGCCAGCACAATGGTGTGCAGGG - Intergenic
1044841756 8:96343117-96343139 TGGCATCTCAAGGGAGCACCAGG + Intergenic
1048250443 8:132862626-132862648 TGCCATGTCAATGGAGTGTAGGG - Intergenic
1049198645 8:141329347-141329369 TGGCAGCTGAATGGAGGGCCAGG - Intergenic
1049698142 8:143993669-143993691 TGCCATCTCCACGGAGCACCTGG - Intronic
1050014579 9:1220298-1220320 TCCCATGTGAATGGAGAGCCTGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057163857 9:92911046-92911068 TGCCGTGTCACTGGAGTGCAGGG - Intergenic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1186758708 X:12700757-12700779 TACTATCTCACTGGAGTGGCTGG - Intronic
1192196812 X:69034097-69034119 TGCCATGGCAATGGCCTGCCAGG - Intergenic
1196793353 X:119483386-119483408 TTCCATATCAATGGATTCCCTGG - Intergenic