ID: 1132506885

View in Genome Browser
Species Human (GRCh38)
Location 16:314667-314689
Sequence TTGCAGGTATGGATCCTGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132506885_1132506890 -10 Left 1132506885 16:314667-314689 CCCGCCAGGATCCATACCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1132506890 16:314680-314702 ATACCTGCAAACAGGCAAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 144
1132506885_1132506891 -9 Left 1132506885 16:314667-314689 CCCGCCAGGATCCATACCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1132506891 16:314681-314703 TACCTGCAAACAGGCAAGCAGGG 0: 1
1: 0
2: 2
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132506885 Original CRISPR TTGCAGGTATGGATCCTGGC GGG (reversed) Exonic
901835740 1:11922952-11922974 TTGCAGGCATAGATCTTGACAGG + Exonic
904166651 1:28560714-28560736 TTACAGGTGTGGCTCCTGGAAGG - Exonic
908392922 1:63699592-63699614 TGGCAGGTATGGATCAAGGCTGG + Intergenic
910949888 1:92634895-92634917 TTGCAGCTAAGGGTCCTGACTGG - Intronic
911827278 1:102503206-102503228 GTGCAGGTAAGGATCATGGTTGG + Intergenic
913281654 1:117190616-117190638 GGGCAGATATGGATCCTGTCTGG - Intronic
919479381 1:198068861-198068883 TTGTAGGAATGCATCCTTGCAGG + Intergenic
922312140 1:224404556-224404578 TAGCAGGTGTGTATCCTGGGAGG + Exonic
922703789 1:227778336-227778358 TTGGAGCTGTGGGTCCTGGCAGG + Intronic
923452825 1:234135871-234135893 TTGCAAGTTTGGTTCTTGGCTGG - Intronic
1063109218 10:3020304-3020326 TAGCAGGTATTTATCCTGGAAGG - Intergenic
1066663033 10:37755173-37755195 TAGCATGGATGGATCCTGCCAGG - Intergenic
1067479377 10:46585182-46585204 TGGAAGGTCTGGATCCTGCCTGG - Intronic
1067615361 10:47756616-47756638 TGGAAGGTCTGGATCCTGCCTGG + Intergenic
1069609316 10:69762119-69762141 TTGCTGGGATGGCACCTGGCAGG - Intergenic
1069868963 10:71521589-71521611 TGTCAGGTTTGGCTCCTGGCAGG - Intronic
1070535745 10:77375993-77376015 TTGCAGGTAGGGTTCTTGGAAGG - Intronic
1070571646 10:77644194-77644216 TTGCAAGTTTGTATCTTGGCAGG - Intergenic
1070609716 10:77925436-77925458 GTGCAGGAACGGATACTGGCGGG - Intronic
1071630763 10:87216567-87216589 TGGAAGGTCTGGATCCTGCCTGG + Intergenic
1073135060 10:101215815-101215837 GCGCAGGCATGGATCCTGCCTGG + Intergenic
1075384854 10:122048253-122048275 TAGTAGGTATGGCTCCTGCCTGG - Intronic
1075694892 10:124426771-124426793 TTAAAGGAAAGGATCCTGGCCGG - Intergenic
1076843462 10:133057774-133057796 GTGCAGGTAAGGGACCTGGCAGG + Intergenic
1076904781 10:133356389-133356411 TGGCAGGTCAGGATCCTGGGCGG + Intronic
1082802529 11:57425419-57425441 CTGCAGGTGTGGTGCCTGGCAGG + Intronic
1084526968 11:69703833-69703855 GTCCACGTATGGATCCTGGCCGG - Exonic
1085757118 11:79211019-79211041 TTGCAGGTGTGGTTCCAGGTTGG - Intronic
1086500734 11:87450784-87450806 TTCCAGGAATGGACTCTGGCTGG - Intergenic
1091219376 11:133920953-133920975 TGGCAGGTAGGACTCCTGGCTGG + Exonic
1093636457 12:21476294-21476316 TTGCAGGTATTTATTCTGCCTGG - Intronic
1094115455 12:26907048-26907070 TTGCAGGTTTGGCTGTTGGCTGG - Intronic
1096002892 12:48144201-48144223 TGGCAGGTATGGCTGTTGGCAGG - Intronic
1096989813 12:55791396-55791418 TTGAAATTATGGCTCCTGGCCGG + Intronic
1097394861 12:59061087-59061109 TAGAAGTTATGGAACCTGGCAGG - Intergenic
1097935682 12:65248188-65248210 TTGCAGGGAGGGATCTTGGTCGG - Exonic
1102297650 12:111749274-111749296 ATGCAGTGATGGATCCTGCCGGG - Exonic
1102492985 12:113299937-113299959 CTGCTGGTGTGGGTCCTGGCAGG - Exonic
1103180824 12:118909759-118909781 CCCCATGTATGGATCCTGGCAGG + Intergenic
1104462379 12:128966249-128966271 TTTCAGGCAGGGATGCTGGCTGG - Intronic
1112788630 13:102979584-102979606 TTGCTCTTATGGCTCCTGGCAGG + Intergenic
1114412729 14:22516052-22516074 TTGAAGGTATGGGCCTTGGCAGG - Intergenic
1114721761 14:24890087-24890109 TTGCTTGTATGGATTGTGGCAGG - Intronic
1117741495 14:58823777-58823799 ATGTAAGAATGGATCCTGGCTGG + Intergenic
1121124148 14:91395215-91395237 TTGCAGGTAGGGGTCTTGGGAGG - Intronic
1121945143 14:98113222-98113244 TTGCAGGTATGGATGATGCTAGG - Intergenic
1122213564 14:100188701-100188723 TTGCAGGTCTGCAACCGGGCAGG - Intergenic
1122828592 14:104384185-104384207 TTGCAGGCCTGGCTCCTGCCTGG - Intergenic
1122909994 14:104822911-104822933 TTGCAGGGATGGATCCTCAAAGG - Intergenic
1125750077 15:42021909-42021931 ATGCAGGGATGGAACCTGGTTGG + Intronic
1127572118 15:60253874-60253896 TCACAGGTCTGAATCCTGGCTGG + Intergenic
1128320688 15:66691762-66691784 CTGCAGGGGTGGATCCAGGCTGG + Intergenic
1130059940 15:80562212-80562234 TTACAGGCATGGGGCCTGGCTGG + Intronic
1132506885 16:314667-314689 TTGCAGGTATGGATCCTGGCGGG - Exonic
1134162020 16:11899207-11899229 TTACAGGTATTGATCCTTTCCGG - Intronic
1134531607 16:14988593-14988615 TTGCAGGCATAGATCTTGACAGG + Intronic
1135208679 16:20504520-20504542 TAGCAGGCATGGATCCTGTCTGG - Intergenic
1135231032 16:20707565-20707587 TAGCAGGCGTGGATCCTGTCTGG - Intronic
1140873561 16:79129077-79129099 TTGCAAGTATGGATCTTGATAGG + Intronic
1142113389 16:88343976-88343998 TTGATGGTGTGGATCCTGGACGG + Intergenic
1142337925 16:89502258-89502280 CAGAAGGTAAGGATCCTGGCAGG - Intronic
1145289773 17:21534007-21534029 CTGCAGCAATGGATCCTGACAGG + Exonic
1146312408 17:31779336-31779358 TTTCAGCTAAGGAGCCTGGCAGG + Intergenic
1147008921 17:37428086-37428108 TTACAGGAAAGGATCCTGGCAGG + Intronic
1147495515 17:40911711-40911733 CTGCAGGTAGGGATCATGGTGGG - Intergenic
1147690476 17:42311945-42311967 TTGCTGCTATGGCTCCTGGTTGG + Intergenic
1148745101 17:49913756-49913778 TGGGAGGGGTGGATCCTGGCAGG + Intergenic
1151441399 17:74131607-74131629 GCGCAGGTATGGGTCCTGGCAGG - Intergenic
1155305287 18:24472484-24472506 ATGAATGTATGGATGCTGGCAGG + Intronic
1157402332 18:47398905-47398927 TTGCAGGCATGGGACATGGCAGG + Intergenic
1157676878 18:49575363-49575385 CTGCAGGTTTGGATCCTGCCGGG + Exonic
1158201050 18:54940723-54940745 TTGCTGTCATGGATCTTGGCTGG + Intronic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1160400560 18:78607941-78607963 TTGCAGGTATTAATCCGAGCTGG + Intergenic
1164149853 19:22541564-22541586 CTTCAGGTATGGATGCTGTCAGG + Intergenic
1164478350 19:28592298-28592320 TTGGAAGGATGGAGCCTGGCAGG - Intergenic
1166054806 19:40282082-40282104 TTGAAGTTCTGGATCCTAGCTGG + Intronic
1166291818 19:41868508-41868530 TTGCAGGCAAGGAGGCTGGCTGG + Intronic
1166392980 19:42420322-42420344 CTGCAGGTATGTGTCATGGCTGG + Intronic
1167233789 19:48301800-48301822 TTGGAGGAATAGATCCTGGATGG + Intronic
926879888 2:17533203-17533225 TTGCAGGGATGGAACTTGGGTGG - Intergenic
928612487 2:33004200-33004222 TTGCAGGTAGAGATCCTTGTTGG + Intronic
930583504 2:53242282-53242304 TTGCAGGCATGGATGTGGGCTGG - Intergenic
933562200 2:83901652-83901674 TTGCAGGGGTGAATGCTGGCAGG - Intergenic
938387303 2:130876065-130876087 TAGAAGGTAAGGTTCCTGGCTGG - Intronic
940314333 2:152311570-152311592 TTACAGGTGTGAATCCTAGCTGG - Intergenic
942452129 2:176114931-176114953 TGGCAGGAAGGGAACCTGGCAGG + Intronic
946483524 2:220078886-220078908 CCGCAGGTAAGAATCCTGGCTGG + Intergenic
1171178732 20:23075490-23075512 TTGCAGGTGTGGTTCCTTTCTGG - Intergenic
1172778733 20:37423259-37423281 TTGCAGGCCTGGATTCTGCCTGG + Intergenic
1174587775 20:51622156-51622178 TTTCAGGTTTGGATGCTGACAGG - Exonic
1174760224 20:53199967-53199989 TTGCAGCTATGGTTCTTGGAAGG + Intronic
1179500834 21:41807652-41807674 GGGCAGGGATGGACCCTGGCTGG + Intronic
1180976210 22:19850123-19850145 TTGCAGCTGTGGTTTCTGGCAGG - Exonic
1184368753 22:44069253-44069275 TTGCAAGAATGGACCCTGGGTGG + Intronic
1184867405 22:47209366-47209388 TGGCAGGTGTGGCCCCTGGCTGG - Intergenic
950828799 3:15854110-15854132 GTGCAGGTATGGATCCTCAGAGG - Intronic
952540806 3:34365553-34365575 TTGAAGGAATTGATCCTGGGAGG + Intergenic
954099451 3:48358089-48358111 TTGCAGGTCTGGAAGCAGGCAGG - Intergenic
955417313 3:58704707-58704729 CTGCAGGAATGGATGCTGGTGGG - Intergenic
959110646 3:102118284-102118306 TGGCAGGTATGGTATCTGGCAGG - Intronic
961679800 3:128591803-128591825 TTGCAGGTTGGGCTCCTGCCTGG - Intergenic
965670491 3:171142802-171142824 GTACAGATCTGGATCCTGGCAGG + Intronic
965773825 3:172208745-172208767 TGGCAGGGGAGGATCCTGGCCGG - Intronic
966036064 3:175417136-175417158 TTGCAGTTTTGGCACCTGGCTGG - Intronic
967866314 3:194192904-194192926 TTGCTGGGAGGGATCCTGGGGGG + Intergenic
969061118 4:4435932-4435954 TGGCAGGGATGGATCCTCGGGGG + Intronic
969243736 4:5919056-5919078 TTGCTGCTATGGCTCCTGGTTGG + Intronic
969402056 4:6962199-6962221 GTGCAGGTATGGATGGTGGCGGG + Intronic
969601607 4:8179724-8179746 CTGCAGGTCAGGAGCCTGGCGGG - Intergenic
972149954 4:36077087-36077109 TTGCAGGGGTGAATGCTGGCAGG + Intronic
972614205 4:40682661-40682683 TTGCTGGTACGGATCCTGCGTGG - Intergenic
972695149 4:41438219-41438241 TTGCAGATATGGATGATGGAGGG - Intronic
973941621 4:55916710-55916732 TTGGAGGAATGGATTCTAGCTGG + Intergenic
974878312 4:67723615-67723637 TTGCAGGGGTGAATGCTGGCAGG + Intergenic
975178574 4:71315962-71315984 TTGCAGCTTTGGATCCTAACTGG - Intronic
977278179 4:95005510-95005532 TAACATGTATGGCTCCTGGCTGG - Intronic
977847107 4:101779337-101779359 TGGCAGATAGGGATGCTGGCTGG - Intronic
978018916 4:103784977-103784999 TTGCACGTGTGAATGCTGGCAGG + Intergenic
984186907 4:176555346-176555368 TTGGAGGTAGGGATCTTGTCTGG + Intergenic
985379745 4:189380761-189380783 TTGCAGGTATGTGTGCTTGCAGG - Intergenic
986988247 5:13523225-13523247 TTGCAGGAGTGAATGCTGGCAGG + Intergenic
988618942 5:32802783-32802805 TTGCAGGGGTGAATGCTGGCAGG + Intergenic
988922993 5:35961972-35961994 TTTCAGGTATGCATCATGGAGGG - Intronic
990990328 5:61677675-61677697 TTGCAGGTAGGGTTCCTGATGGG - Intronic
993713821 5:91254580-91254602 TTGAAGGCATGGATACAGGCAGG - Intergenic
995804421 5:116035686-116035708 CTTGAGGTCTGGATCCTGGCTGG - Intronic
996078359 5:119225386-119225408 TTGGAGGTATTGATTCTGGTGGG + Intronic
998508367 5:142690474-142690496 TTGAATGTATGGATCCTTTCAGG + Intronic
1001917225 5:175571749-175571771 ATGCAGGGAGGGATCCTGGGAGG + Intergenic
1004745731 6:18507340-18507362 TTGCATGGGTGAATCCTGGCAGG - Intergenic
1005831203 6:29672576-29672598 CTGGGGGTATGGATCCTGGGGGG + Exonic
1007278721 6:40694561-40694583 TTCCAAGTATTGATCCAGGCTGG - Intergenic
1008958811 6:57245010-57245032 CTGCAGGGATGGCTCCCGGCAGG + Intergenic
1017032163 6:150233853-150233875 TTGCAGGGCTGGTTCCTGCCTGG - Intronic
1020047098 7:5048468-5048490 TTTAAAGTATGAATCCTGGCTGG - Intronic
1020292458 7:6732330-6732352 TTTAAAGTATGAATCCTGGCTGG - Intergenic
1022370976 7:29771046-29771068 TTGCATGTCTGCTTCCTGGCAGG - Intergenic
1022384668 7:29890082-29890104 TTACAGGCATGGATCATGCCTGG - Intronic
1023392371 7:39722418-39722440 TTGCAGGGGTGAATGCTGGCAGG - Intergenic
1024986598 7:55199666-55199688 TTGGAGGTATGGCTACTGCCTGG - Intronic
1026727636 7:72881925-72881947 TTTAAAGTATGAATCCTGGCTGG - Intronic
1027116200 7:75483802-75483824 TTTAAAGTATGAATCCTGGCTGG + Intronic
1027121452 7:75525218-75525240 TTTAAAGTATGAATCCTGGCTGG + Intergenic
1027275625 7:76551896-76551918 TTTAAAGTATGAATCCTGGCTGG - Intergenic
1029721332 7:102366450-102366472 TTTAAAGTATGAATCCTGGCTGG - Intronic
1032094294 7:128929893-128929915 CTCCAGGTGAGGATCCTGGCAGG - Intergenic
1033716852 7:144011129-144011151 ATGCAAGTCTGAATCCTGGCAGG - Intergenic
1037975317 8:23206357-23206379 TTGCAGGACTGGATCTTGTCTGG - Intronic
1040024772 8:42771749-42771771 TTGAAACTATGGATCCTGCCGGG + Intronic
1040634818 8:49260584-49260606 GTGCAGGTCTTGATCCTGGCTGG + Intergenic
1041412972 8:57577014-57577036 CTGCTGGAATGGATCCTGGAAGG + Intergenic
1043150031 8:76704192-76704214 TTGCAGGGATGGAGCCTGACAGG + Exonic
1047312753 8:123706371-123706393 TCTCAGGCCTGGATCCTGGCAGG + Intronic
1052321474 9:27172223-27172245 CTGCAGGTATGGTTACAGGCTGG - Intronic
1052952136 9:34221231-34221253 TTGAAGGTATAGTTACTGGCTGG + Intronic
1056488680 9:87084237-87084259 CCGCAGGTATGGATACTTGCTGG + Intergenic
1057178466 9:93016196-93016218 TTGCAGGGAGCAATCCTGGCTGG + Intronic
1057355808 9:94330425-94330447 TTGCATGTGTGAATCCTGGTTGG + Intergenic
1057651950 9:96927204-96927226 TCGCATGTGTGAATCCTGGCTGG - Intronic
1060204578 9:121674999-121675021 CTGCAGTTATGGAACCTGGTTGG - Intronic
1062227265 9:135459922-135459944 TTGTAGGTATGCAGCATGGCTGG + Intergenic
1187735162 X:22295658-22295680 TTGGGGGTGTGGAGCCTGGCTGG - Intergenic
1190037053 X:47035150-47035172 TTGCTGGTTTGGATAGTGGCTGG - Intronic
1192299685 X:69886709-69886731 TAGCAGCTGTGGATCCTGTCTGG - Intronic
1193050725 X:77096587-77096609 TTGCAAGTCTGAAACCTGGCTGG - Intergenic
1194617297 X:96121148-96121170 TTGCAGGTTAGGGGCCTGGCGGG + Intergenic
1198718356 X:139587248-139587270 GAGAAGGTATGGATCCTGGGAGG - Intronic
1199581818 X:149368180-149368202 CTCCAGGTAGGGCTCCTGGCTGG + Intergenic