ID: 1132509868

View in Genome Browser
Species Human (GRCh38)
Location 16:334165-334187
Sequence GTGCTGTTATTGGTGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132509868_1132509875 20 Left 1132509868 16:334165-334187 CCATGGCACACCAATAACAGCAC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1132509875 16:334208-334230 TAACACAGCACCCAGTACCATGG 0: 7
1: 8
2: 4
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132509868 Original CRISPR GTGCTGTTATTGGTGTGCCA TGG (reversed) Intronic
900431354 1:2604581-2604603 GTGCTGGGCTTGGGGTGCCAGGG + Intronic
900715330 1:4140380-4140402 GCTTTGTTCTTGGTGTGCCATGG - Intergenic
902863052 1:19259616-19259638 GTGCTGTCATGGCAGTGCCAAGG - Exonic
903797460 1:25940486-25940508 CTGCTGTTATTTGTCTCCCATGG - Intergenic
904997469 1:34642185-34642207 TTGCTGTTAGTGGTGTGGGAGGG - Intergenic
908091264 1:60687553-60687575 GTGCTGAGATTGGGGTGTCAGGG - Intergenic
911770607 1:101736314-101736336 GTGTTATTATTGGTGTGTAAGGG - Intergenic
918176298 1:182048636-182048658 GTGCTGGCTTTGGTGTACCATGG - Intergenic
918856819 1:189766046-189766068 GTCCTGTTATTACTGTGGCAAGG + Intergenic
920511456 1:206555460-206555482 GAGCTGTTATTGATGGCCCAAGG + Intronic
1062902473 10:1156433-1156455 GTGCTGTCATTGGCCTGTCAGGG + Intergenic
1062916062 10:1241952-1241974 GCGGCTTTATTGGTGTGCCAGGG + Intronic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1076293160 10:129363165-129363187 GGACTCTTATGGGTGTGCCAGGG + Intergenic
1078604339 11:12761874-12761896 CTGCTGTTAGTGGTGTTCAAGGG + Intronic
1080424646 11:32144723-32144745 GAACTGTTATTGGTTTGCCAAGG + Intergenic
1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG + Intronic
1085247103 11:75111156-75111178 ATGCTGTTCTTTGTGTCCCAAGG - Intronic
1086148215 11:83579053-83579075 GAGCTGTTATTGTTGAGGCAAGG - Intronic
1089862467 11:121602186-121602208 GAGCTGAAATTGGTTTGCCATGG - Intronic
1094559474 12:31537610-31537632 GTGTTGTTATTGATGAGCAAGGG - Intronic
1095925055 12:47570085-47570107 GTGCTTTTGTTGGTGTGCAGAGG - Intergenic
1095941276 12:47728742-47728764 ATGCTGTTATTGGACTGGCAGGG + Intergenic
1099449186 12:82788457-82788479 GTGCTCTTATTGCTGTTCCTAGG - Intronic
1100253611 12:92858830-92858852 GACTTGTTATTGGTGTGCCTCGG + Intronic
1106197591 13:27507569-27507591 GTGCTGTGAATGGTGTGCCCCGG + Intergenic
1107378671 13:39832237-39832259 GTTCTGACATGGGTGTGCCAAGG - Intergenic
1107729237 13:43331680-43331702 GTGCTGGAATTGGTGAGCCTTGG + Intronic
1113157263 13:107337923-107337945 TTGCTGTTATTTGCGTGACACGG - Intronic
1113321190 13:109234194-109234216 TTGCTGTTCTCTGTGTGCCAAGG - Intergenic
1113349760 13:109517722-109517744 GTGCTATTACTGGTCTGTCAAGG + Intergenic
1115550285 14:34498978-34499000 CTGCTGTTATATTTGTGCCATGG + Intergenic
1116441309 14:44956855-44956877 ATGCTGAAATTGGTGTGCAATGG + Intronic
1118747934 14:68787166-68787188 GTTCTTTTATTGGGGTGCCTTGG - Intergenic
1126643559 15:50852801-50852823 TTACTGTTATTGGAGTGCAATGG + Intergenic
1127041320 15:54980082-54980104 GTGCTGTTAGTGATGTGGTATGG + Intergenic
1128616958 15:69117736-69117758 GTGCTGGTCTTGCTGTGCCGAGG - Intergenic
1130204921 15:81866940-81866962 GTGCTGTTGTGTGTGTCCCAGGG - Intergenic
1132509868 16:334165-334187 GTGCTGTTATTGGTGTGCCATGG - Intronic
1132510025 16:335522-335544 GCTATGTTATTGGTGTGCCGTGG - Intronic
1137008108 16:35297253-35297275 GTGATGTTATTGTTATCCCAGGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138575426 16:57904432-57904454 CTGGTGTTTCTGGTGTGCCAGGG - Intronic
1144204862 17:12973048-12973070 GAGTTGATATTGGTGTGGCATGG - Intronic
1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG + Intronic
1149258261 17:54851415-54851437 GTGCTTATATTTTTGTGCCATGG - Intergenic
1150692111 17:67375756-67375778 TTGCTGTTATTGGTTTGTGATGG - Intergenic
1151735832 17:75939880-75939902 GTCCTGTTATTGGAATGCAAGGG + Intronic
1151935733 17:77259695-77259717 GTGCAGTTATGGGACTGCCAAGG + Intergenic
1153879572 18:9408664-9408686 GTGCTTTTCTGGCTGTGCCAGGG - Intergenic
1158880453 18:61774306-61774328 GTGCTGTTAGTGGTGGGGCTGGG - Intergenic
1164647353 19:29869168-29869190 GTGATGTTTTTCGTGTGCAATGG + Intergenic
1166178758 19:41092494-41092516 GAGCTGTTATAAGTGTTCCATGG - Intronic
926640677 2:15232481-15232503 GTGCTGACCTTGGTGGGCCAAGG - Exonic
935212249 2:100948009-100948031 GTGCTGTTGTCTGTGGGCCAAGG - Intronic
941108111 2:161385035-161385057 GTGGTGTAATTGATGTGACAGGG + Intronic
947456277 2:230256955-230256977 GTGCTGTTATTGCTGTTTTAAGG + Intronic
1172159360 20:32855256-32855278 GTGCTGTAAGTGGAATGCCACGG + Intergenic
1172740433 20:37162254-37162276 GGGATGTTAGTGGTGTGCCCTGG - Intronic
1176229501 20:64024792-64024814 GTGCTGTTGTTGGGGTGCACTGG + Intronic
1181171962 22:21014962-21014984 CTGCTGTTCTCTGTGTGCCAGGG + Intronic
1184023871 22:41839250-41839272 GTGCTGAAATTGGGGTGCCTGGG + Intronic
1185312259 22:50162677-50162699 GAGCTGTCATTGCTGTGCTAAGG + Intergenic
949824047 3:8145977-8145999 GTGCTATTTTTGTTCTGCCATGG - Intergenic
949911117 3:8908677-8908699 GTGTTTTTATTAGTGTGCTAGGG - Intronic
950759523 3:15208339-15208361 GAGCTATTATTAGTGGGCCACGG - Intronic
952656956 3:35797994-35798016 GTGCTGTGATGTGAGTGCCAAGG - Intergenic
953985943 3:47443043-47443065 GTGCTGTCAAGTGTGTGCCAGGG - Exonic
954994482 3:54869055-54869077 GTGATGTGAGTGGTGTGACACGG + Intronic
955019628 3:55106803-55106825 AGGCTGTTTTTGGTGAGCCAAGG - Intergenic
957389114 3:79538590-79538612 TTGCTATTGTTGATGTGCCAGGG - Intronic
960577918 3:119245515-119245537 GTGCTGTTAGTGGGGCACCATGG + Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
973805142 4:54518495-54518517 CTGCTGTTATTTGTTTGCTAGGG - Intergenic
976266665 4:83191723-83191745 GTGCTGTGATTGGTAGGCCGAGG + Intergenic
987734060 5:21816149-21816171 GGGCTGGTATTGCTGTGTCAGGG - Intronic
988014612 5:25537885-25537907 GTTCTGATATTGGTAAGCCATGG + Intergenic
988505668 5:31820330-31820352 GAGCTGTTTTTCGTTTGCCATGG - Intronic
989000287 5:36752706-36752728 TTCCTGACATTGGTGTGCCAGGG - Intergenic
989275235 5:39581179-39581201 GTGGTGTCATTTGTGTGCAAAGG + Intergenic
990620481 5:57553898-57553920 GTGCTGGTCTTGGTGTTCCTTGG - Intergenic
991334987 5:65537057-65537079 GTGCTGTTTTTGGTGAGGGAAGG - Intronic
991627769 5:68622097-68622119 GTGCTGGTATTAGTTTGCTAGGG + Intergenic
994150640 5:96443684-96443706 GTGATTTAATTGGTGTGGCATGG + Intergenic
996805857 5:127453054-127453076 GTTCTGATGTTGGTGTCCCATGG - Intronic
997221415 5:132169259-132169281 GTACTCTTTTTGGTGTACCATGG - Intergenic
998505483 5:142668861-142668883 GTGCTGTGAAGGTTGTGCCAAGG + Intronic
999324163 5:150632771-150632793 GTGCTATTCTTAGTGTGACAGGG + Intronic
1006262835 6:32890953-32890975 GTGCTATTATTGGTGAGAGAGGG - Intergenic
1006785124 6:36661313-36661335 GTGCTGTGTTTGGTGTGTCAAGG - Intergenic
1009732598 6:67629160-67629182 GTCCTGTGACTGGTGTGCAAAGG - Intergenic
1013295097 6:108751859-108751881 CTGCTGTTCTTCTTGTGCCAAGG + Intergenic
1015077471 6:129177752-129177774 GAGCTGTGATCGGTGTGCCAGGG + Exonic
1016553420 6:145308574-145308596 GTGCAGTTTGTGGTGTGCCAAGG + Intergenic
1016826805 6:148395951-148395973 GTGCAGTTGTTGATGTGGCACGG + Intronic
1021653336 7:22852602-22852624 GTGCTGTGATTGGTGTTGGAGGG - Intergenic
1022489865 7:30808306-30808328 GTGCCGGTATAGGTATGCCATGG - Intronic
1023526658 7:41110833-41110855 CTGCAGGTTTTGGTGTGCCATGG - Intergenic
1024252226 7:47514852-47514874 GTGCTGTTATGGGTGAGTCTCGG - Intronic
1027950641 7:84810415-84810437 CTGCTGTTTTTGGTTTCCCAAGG - Intergenic
1032072405 7:128816379-128816401 TTGCTGTTAGGGGTGTGTCAGGG + Intronic
1034517174 7:151590121-151590143 GTGATGACATTTGTGTGCCAGGG + Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1042201762 8:66285467-66285489 GTGGAGTGATTGGTTTGCCATGG - Intergenic
1046775220 8:118157373-118157395 ATCCTGGTATTGGTGTTCCATGG - Intergenic
1049217073 8:141413142-141413164 GGGCTGTGCCTGGTGTGCCAGGG + Intronic
1051045857 9:12872751-12872773 ATGCTGATATTGATGTGCCTTGG + Intergenic
1055301676 9:74889128-74889150 TTGCTGTTGTTGTTGAGCCAGGG + Intergenic
1058212116 9:102181995-102182017 GAGCAGTTATTTGTGTGCAAGGG - Intergenic
1058233555 9:102461499-102461521 GTGCTGTTGCTGGTGGGGCAGGG + Intergenic
1187658167 X:21505133-21505155 ATACTGTTTTTGGTGTGCAAAGG + Intronic
1189626639 X:42904115-42904137 GTGATGATATTGGTGAGGCAAGG - Intergenic
1190129436 X:47733455-47733477 GTGCTGTTGGTGGTGGTCCAGGG - Intergenic
1193928370 X:87520082-87520104 ATGGTTTTATAGGTGTGCCAAGG + Intronic
1194457215 X:94119481-94119503 TCGCTGTTATTGGTGTGTTAAGG + Intergenic
1196432101 X:115637949-115637971 TTGCTGTTGTTGTTGTGACAGGG + Intronic
1198439128 X:136644780-136644802 TTCATGTTATTTGTGTGCCAAGG - Intergenic
1199052781 X:143257112-143257134 GTGCTGTTTTTGGTCTGCATTGG - Intergenic
1199502679 X:148525963-148525985 GAGCTGTGACTGGTGTGCCCTGG - Intronic
1200044404 X:153393385-153393407 GTGCGTTTAATGGTGTGACAGGG + Intergenic