ID: 1132510278

View in Genome Browser
Species Human (GRCh38)
Location 16:337450-337472
Sequence CTAGCTCACCTGTAGTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132510278_1132510280 -7 Left 1132510278 16:337450-337472 CCCATAGACTACAGGTGAGCTAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1132510280 16:337466-337488 GAGCTAGTAAAGATCCAGAGTGG 0: 1
1: 0
2: 1
3: 19
4: 123
1132510278_1132510281 -6 Left 1132510278 16:337450-337472 CCCATAGACTACAGGTGAGCTAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1132510281 16:337467-337489 AGCTAGTAAAGATCCAGAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 141
1132510278_1132510284 29 Left 1132510278 16:337450-337472 CCCATAGACTACAGGTGAGCTAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1132510284 16:337502-337524 AAAAAAAAAAAAAAAAGCACTGG 0: 75
1: 1908
2: 12754
3: 66219
4: 91372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132510278 Original CRISPR CTAGCTCACCTGTAGTCTAT GGG (reversed) Intronic
903996199 1:27306833-27306855 CTAGCTCCCCTGTGGTCTTCAGG + Exonic
905010142 1:34741734-34741756 CCAGCCCAACTGTAGTCTCTGGG + Intronic
907445163 1:54502861-54502883 CTCAGTCACCTGTAGTCTCTGGG - Intergenic
908644874 1:66266411-66266433 TTAGCTCTCCTGGAGTTTATTGG - Intronic
917966331 1:180181128-180181150 CTAGCTAACCTGTATTGCATAGG - Intronic
919371703 1:196736221-196736243 CTAGCTTACCTGTACTGTTTAGG - Intronic
924788154 1:247219465-247219487 TTGGCTCCCCTGTAGTCTCTGGG - Intergenic
924805033 1:247355143-247355165 TTGGCTCCCCTGTAGTCTCTGGG - Intergenic
1065125204 10:22567413-22567435 CTTTCTCACCTGTAGTATGTTGG - Intronic
1065473722 10:26111284-26111306 CTAGCTCATCTGTAGTCTTTGGG - Intronic
1067976169 10:51027396-51027418 CTAGCTCACCTAAAGGCTATTGG + Intronic
1086561350 11:88173328-88173350 GTTGCTCACCTGTCATCTATTGG + Intronic
1089662325 11:119993668-119993690 CTAGCACCCTTATAGTCTATAGG + Intergenic
1092879581 12:12877640-12877662 CCAGCTCACCTGTAATCTCAGGG - Intergenic
1100698154 12:97117896-97117918 CTTGCTCACCTGTAAAGTATAGG - Intergenic
1113174359 13:107545476-107545498 TTTGCTCTGCTGTAGTCTATTGG - Intronic
1117107937 14:52418046-52418068 CTACCTAACTTGTGGTCTATGGG + Intergenic
1120031072 14:79641568-79641590 CTAGCTGACCTGCAGTCCAAAGG - Intronic
1124182550 15:27490435-27490457 CCAGCTCACCTGAAGACTCTTGG + Intronic
1132206529 15:99989635-99989657 GTAGCTCACCTACAGTCTTTGGG + Intronic
1132510278 16:337450-337472 CTAGCTCACCTGTAGTCTATGGG - Intronic
1132935629 16:2479335-2479357 CTAGTTCACCTGCAGTCTGAGGG + Intronic
1150309669 17:64117711-64117733 CTCGCTCACCTGTCTTGTATAGG - Intronic
1159960778 18:74554553-74554575 CCAGCTCACCTTCACTCTATGGG + Intronic
928783991 2:34859457-34859479 ATAGCTTTCCTGTAGTCTTTAGG - Intergenic
932049507 2:68384500-68384522 CTAGCCCACCTGTAATCTTAGGG - Intronic
933309802 2:80646449-80646471 CTAGCTCACATGTAGACTCCTGG + Intronic
939822580 2:146976122-146976144 CTATCTCAGCTGTAGTGTAGTGG - Intergenic
942441445 2:176041673-176041695 CTAGCCCACATCTAGTCTTTAGG - Intergenic
948154580 2:235771098-235771120 ACTGCTCACCTGTAGTCTCTGGG + Intronic
1168879653 20:1195664-1195686 CTAATGCACCTGTAGTGTATTGG - Intergenic
1168928698 20:1604036-1604058 CCAGGTCAGCTGTAGTCTCTGGG + Intronic
1168969680 20:1922397-1922419 CCAGGTCAGCTGTAGTCTCTGGG - Exonic
1182470141 22:30543407-30543429 CCAGGTCAACTGTAGTCTCTGGG - Intronic
1183123013 22:35745848-35745870 CTAGATCTTCTGTAGTCTACGGG + Intronic
1184147224 22:42618885-42618907 CTAACACAACTGTAGTCTAAAGG + Exonic
966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG + Intergenic
973291055 4:48471155-48471177 CTAACATACCTGTAGTCTGTTGG + Intergenic
976514697 4:85951396-85951418 CTAGCTCAACTTTAGTCATTGGG + Intronic
978498668 4:109385880-109385902 CTAGGTCAGCAGGAGTCTATGGG + Intergenic
979156107 4:117392558-117392580 CTAGCTCAGCTGTAGTAAAATGG + Intergenic
982722414 4:158872109-158872131 TTAGTTCCCCTGTAGTCTCTTGG - Intronic
984610279 4:181829628-181829650 CTACCTCGCCTGGAGCCTATTGG - Intergenic
985241377 4:187934083-187934105 CTAGTTCACCTGCAGCCTCTGGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1015508897 6:134017978-134018000 CTAGGTCACCTGCAGTCCAGAGG - Intronic
1018631427 6:165826205-165826227 CCAGGTCACCTGGAGTCTACAGG - Intronic
1027452772 7:78351674-78351696 CTAGTTCAGCTGTAGTCTAGGGG - Intronic
1049136806 8:140909368-140909390 TTAGCTGTCCTGTAATCTATAGG - Intronic
1057095066 9:92299081-92299103 CTCGCTCACCTGGATTCTAGGGG - Intronic
1057894040 9:98892118-98892140 CAAGCTCACATGTATGCTATTGG - Intergenic
1060569341 9:124623753-124623775 CTACCTCAGCTGTACTATATGGG + Intronic
1188366706 X:29324554-29324576 CTAACTTACCTGTTGACTATAGG - Intronic
1188713831 X:33435755-33435777 CTAGCTCACCTTTTCTTTATTGG - Intergenic
1195749355 X:108148775-108148797 CTTGCCCACCTGTGGTCTAGGGG + Intronic
1196324067 X:114380908-114380930 CTAACTCACCAGCAGTGTATAGG - Intergenic