ID: 1132511203

View in Genome Browser
Species Human (GRCh38)
Location 16:342457-342479
Sequence GTGAGCATTGCTACCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132511203 Original CRISPR GTGAGCATTGCTACCACAGC AGG (reversed) Intronic
903847733 1:26288487-26288509 GTGGGAAGAGCTACCACAGCAGG + Intronic
907678322 1:56539361-56539383 GTGAGCATTTTTATCACTGCTGG - Intronic
908136607 1:61139635-61139657 ATGAACAATGCCACCACAGCAGG - Intronic
908876864 1:68687234-68687256 TTGCTCATTGCTACCACAGCAGG - Intergenic
912316418 1:108670975-108670997 GTCACCATAGCCACCACAGCTGG - Intergenic
917387278 1:174491145-174491167 GTCATCATAGCTACCACAGCTGG + Intronic
918387939 1:184029406-184029428 GTGAGCTTTGCTCCCACCTCAGG - Intronic
920227186 1:204447318-204447340 GTGGGCATTGCCATCTCAGCAGG - Intronic
922766720 1:228159942-228159964 GTGTGCATGGCTACCACATGGGG + Intergenic
922798037 1:228351206-228351228 GTGAGCACAGGTAGCACAGCTGG + Intronic
1063178151 10:3570798-3570820 CTGAGCACTGATACCACAGCGGG + Intergenic
1077386351 11:2271209-2271231 GGGAGCATCGCTAACAAAGCTGG + Intergenic
1079994247 11:27278980-27279002 CTGAGCATTGCTCCTACAGCAGG - Intergenic
1081553306 11:44134083-44134105 GTGAGCAGTGCTGCCACACGTGG + Intronic
1083409481 11:62482007-62482029 GTGAGCATGGCTGACCCAGCAGG - Intronic
1086604164 11:88675029-88675051 GTGAACATTGGTACCATAGTAGG - Intronic
1090451553 11:126810834-126810856 GTCAGAACTGCAACCACAGCTGG - Intronic
1090779274 11:129992540-129992562 GAGAGCACGGCTACAACAGCAGG - Intronic
1095101037 12:38184115-38184137 TTCACCATAGCTACCACAGCTGG - Intergenic
1097993741 12:65864547-65864569 GTGAGCATTCATAGCAAAGCTGG - Intronic
1102841209 12:116125410-116125432 CTGACCTGTGCTACCACAGCAGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1114783743 14:25570226-25570248 TTCACCATTGCCACCACAGCTGG + Intergenic
1117816398 14:59603240-59603262 GTAAACATTGAAACCACAGCTGG + Exonic
1118065680 14:62187785-62187807 AAGAGCATTGCTAGAACAGCGGG + Intergenic
1119013948 14:71029908-71029930 ATGAGCATCTCTAACACAGCAGG - Intronic
1119059933 14:71463900-71463922 GTGGGCATAGCTACCACAATGGG - Intronic
1132511203 16:342457-342479 GTGAGCATTGCTACCACAGCAGG - Intronic
1132867649 16:2101774-2101796 GTGAGCATCGCTACCACTGTGGG - Intronic
1134524129 16:14931340-14931362 ATGAGCATCGCTACCACTGTGGG + Intronic
1134548774 16:15129595-15129617 ATGAGCATCGCTACCACTGTGGG - Intronic
1134711719 16:16329825-16329847 GTGAGCATCGCTACCACTGTGGG + Intergenic
1134719572 16:16373124-16373146 ATGAGCATCGCTACCACTGTGGG + Intergenic
1134947854 16:18338761-18338783 ATGAGCATCGCTACCACTGTGGG - Intergenic
1134955109 16:18378868-18378890 GTGAGCATCGCTACCACTGTGGG - Intergenic
1136040507 16:27575117-27575139 GTGAGAAGTGCTATCACAGAAGG + Intronic
1136143098 16:28299660-28299682 GTGTGCGATGCTGCCACAGCTGG + Intronic
1140718666 16:77750360-77750382 GTGAAACTTGCCACCACAGCGGG - Intergenic
1142009592 16:87707104-87707126 TTGAGCATTGAAACCACACCTGG - Intronic
1143819731 17:9550676-9550698 GTGAGCATTTGAACCACAGATGG + Intronic
1146314030 17:31793286-31793308 GTGGGCTTTGGGACCACAGCCGG - Intergenic
1150852028 17:68712624-68712646 GTTAGCATTGGTACCAGACCTGG + Intergenic
1154163894 18:11999696-11999718 GTGGGAATGGCTGCCACAGCCGG + Intronic
1155282128 18:24250679-24250701 TTGACCATAGCCACCACAGCTGG - Intronic
1158817301 18:61117870-61117892 GTGATCAATGATACCATAGCTGG + Intergenic
1160675897 19:391033-391055 GGGGGCCTTGCTACCCCAGCAGG - Intergenic
1164981859 19:32620075-32620097 CTGAGCAGTGCCACCACGGCTGG - Intronic
1167008723 19:46792265-46792287 GTGAGCACTGCTAACAGAGATGG - Intergenic
925153784 2:1635089-1635111 ATGAGTATTCCTGCCACAGCTGG + Intronic
930021676 2:47005400-47005422 GTGAGAATTGCAAACACACCAGG + Intronic
932820541 2:74895900-74895922 CTGAGGAATGCAACCACAGCTGG + Intergenic
938032861 2:128010335-128010357 GAGACAGTTGCTACCACAGCAGG + Exonic
940509004 2:154588712-154588734 GCAACCATTGCTACCAAAGCTGG - Intergenic
942923388 2:181404482-181404504 TTGAGCAATACTACCACAGAAGG - Intergenic
947669488 2:231927236-231927258 GTGCGCATTGTTCCCACAGAGGG - Intergenic
1169476925 20:5940026-5940048 CTGAGCATGGGTACCAGAGCTGG + Intronic
1171557968 20:26095546-26095568 GTCAGCAATGCTACTACAGGGGG - Intergenic
1172304601 20:33872084-33872106 GTGAGCAGAGGTACCGCAGCAGG + Intergenic
1174091964 20:48056397-48056419 GTCAGCCTTGCAGCCACAGCAGG + Intergenic
1175252435 20:57617447-57617469 GTGAGCCATGCAAGCACAGCAGG - Intronic
1175932553 20:62499446-62499468 GTGTCCATTGCTCCCACATCGGG - Intergenic
1177329643 21:19641105-19641127 GTGATCATTGCTAGCTCCGCCGG - Intergenic
1178523352 21:33304151-33304173 ATGAGCATTTCTGCCACGGCGGG + Intergenic
1180672381 22:17563258-17563280 GTGAGCATTGCTAGCAGAAAGGG - Intergenic
1185311984 22:50161317-50161339 GTGAGCCAGGCTCCCACAGCGGG - Intronic
949516725 3:4814194-4814216 GAGAGCAATACTACCATAGCTGG + Intronic
952853220 3:37746000-37746022 GTGGGCTTTGCTAGCACAGAAGG - Intronic
957149700 3:76470183-76470205 TTTATCATTGCTATCACAGCTGG + Intronic
959257223 3:104031056-104031078 GACAGCAGAGCTACCACAGCCGG + Intergenic
964459230 3:156904128-156904150 CTGGGCATTGTTACCAGAGCTGG + Intronic
969986723 4:11219030-11219052 GTGATCATTGCTCCAACAGAGGG + Intergenic
971676840 4:29642364-29642386 GTGAACAATGCTACCAAATCTGG - Intergenic
975375059 4:73633221-73633243 GTGCACATTGCTACTACAACCGG + Intergenic
978063642 4:104369325-104369347 GTGAGCATTCCTCCCGGAGCAGG + Intergenic
980519976 4:133919066-133919088 GTAAGCATGGCTGCCACAGTTGG - Intergenic
984149128 4:176104244-176104266 TTGAGCATTTCTTCCAAAGCAGG - Intronic
987631456 5:20478175-20478197 CTCCTCATTGCTACCACAGCTGG - Intronic
993932206 5:93954200-93954222 TTCACCATTGCCACCACAGCTGG + Intronic
995290269 5:110443662-110443684 TTCAGCATAGCCACCACAGCTGG + Intronic
1001414867 5:171538340-171538362 CTGAGCATTGCCACCAGAGTGGG - Intergenic
1006823541 6:36917292-36917314 GTGGGCTTTTCTACCCCAGCTGG - Intronic
1011289962 6:85766543-85766565 ATGAACATTCATACCACAGCAGG + Intergenic
1012177683 6:96109087-96109109 GTGAGCATTGCTGCCAAAAGAGG - Intronic
1014766380 6:125411288-125411310 GTGACCATGGCTTCAACAGCTGG + Intergenic
1022749879 7:33213558-33213580 TTCAGCATAGCCACCACAGCTGG + Intronic
1023821448 7:43982915-43982937 TTGAGCATTTCCTCCACAGCAGG + Intergenic
1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG + Intergenic
1028354282 7:89887321-89887343 GTGAGCACTGCCACCACCACTGG + Intergenic
1028739410 7:94255667-94255689 GTAAGCAGTGCTACAACAACCGG - Intergenic
1029749711 7:102536336-102536358 TTGAGCATTTCCTCCACAGCAGG + Intergenic
1029767661 7:102635441-102635463 TTGAGCATTTCCTCCACAGCAGG + Intronic
1030761996 7:113363781-113363803 GTAGGCATTGTTAGCACAGCAGG - Intergenic
1031495082 7:122436628-122436650 CTCAGCATTCCTACCACAGTGGG + Intronic
1031522476 7:122783450-122783472 GAGAGGAGTGCTACCACAGTTGG - Intronic
1033065699 7:138151861-138151883 GTGAGCATCTCTTCCTCAGCTGG - Intergenic
1038000139 8:23384390-23384412 GTGAGCGTTGCTGACACAGAGGG + Intronic
1041176785 8:55205070-55205092 GTGATTAATGCTAGCACAGCTGG + Intronic
1041523934 8:58784934-58784956 GTGAGCATTGCCGCAGCAGCAGG - Intergenic
1042201183 8:66280516-66280538 TTCAGCATTTTTACCACAGCTGG - Intergenic
1042472369 8:69206115-69206137 GTGAGCTTTGCTACCTGTGCTGG + Intergenic
1046135970 8:110027882-110027904 GTGAGCTTTGCTAACAAACCAGG - Intergenic
1048758467 8:137765759-137765781 GTGAGCATAGCTGGCACTGCAGG + Intergenic
1050260217 9:3833649-3833671 TTGAGGATTGATAACACAGCTGG + Intronic
1056461993 9:86817496-86817518 CTGAGCATTCCCACCACATCAGG - Intergenic
1058297999 9:103332917-103332939 GTGAGCATTGCTACAGCACTCGG + Intergenic
1187216606 X:17283044-17283066 GTGGGCATTCCTACCTCAGGAGG + Intergenic
1187442484 X:19332690-19332712 GTCTGCATTGCTCACACAGCTGG - Intergenic
1187686596 X:21821722-21821744 GTTAGTATTTCTACCACAGTTGG + Intergenic
1200968054 Y:9119395-9119417 ATGAGGAGTGCTACCACAGTTGG - Intergenic
1201066992 Y:10106442-10106464 TTCACCATAGCTACCACAGCTGG - Intergenic