ID: 1132514534

View in Genome Browser
Species Human (GRCh38)
Location 16:360044-360066
Sequence CGCTGGGGATAGTGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132514534_1132514545 10 Left 1132514534 16:360044-360066 CCTTCTGCCCACTATCCCCAGCG No data
Right 1132514545 16:360077-360099 CTGCACACCCCAGTGCCCAGCGG No data
1132514534_1132514551 26 Left 1132514534 16:360044-360066 CCTTCTGCCCACTATCCCCAGCG No data
Right 1132514551 16:360093-360115 CCAGCGGTTCCCCCTCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132514534 Original CRISPR CGCTGGGGATAGTGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr