ID: 1132514663

View in Genome Browser
Species Human (GRCh38)
Location 16:360567-360589
Sequence CTCTGGGCAGAACCTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132514652_1132514663 0 Left 1132514652 16:360544-360566 CCCAGCTCGGCCCCTGCGGGCTC No data
Right 1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG No data
1132514653_1132514663 -1 Left 1132514653 16:360545-360567 CCAGCTCGGCCCCTGCGGGCTCC No data
Right 1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG No data
1132514656_1132514663 -10 Left 1132514656 16:360554-360576 CCCCTGCGGGCTCCTCTGGGCAG No data
Right 1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG No data
1132514647_1132514663 17 Left 1132514647 16:360527-360549 CCACGGCTGTCCTCACACCCAGC No data
Right 1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG No data
1132514649_1132514663 7 Left 1132514649 16:360537-360559 CCTCACACCCAGCTCGGCCCCTG No data
Right 1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132514663 Original CRISPR CTCTGGGCAGAACCTGGGGA AGG Intergenic
No off target data available for this crispr