ID: 1132515133

View in Genome Browser
Species Human (GRCh38)
Location 16:362708-362730
Sequence CAAGGCCATCAGAGGGACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132515122_1132515133 10 Left 1132515122 16:362675-362697 CCTTGGGCTGCTGCAGCCCAGGG No data
Right 1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG No data
1132515127_1132515133 -7 Left 1132515127 16:362692-362714 CCAGGGAGGCCACTACCAAGGCC No data
Right 1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG No data
1132515126_1132515133 -6 Left 1132515126 16:362691-362713 CCCAGGGAGGCCACTACCAAGGC No data
Right 1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132515133 Original CRISPR CAAGGCCATCAGAGGGACCC GGG Intergenic
No off target data available for this crispr