ID: 1132517493

View in Genome Browser
Species Human (GRCh38)
Location 16:372598-372620
Sequence CTCCATGTGGGTAAGGAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132517493_1132517502 5 Left 1132517493 16:372598-372620 CCCGGCTCCTTACCCACATGGAG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1132517502 16:372626-372648 GATCACGAAGGCAAAGAGGCAGG 0: 1
1: 0
2: 2
3: 10
4: 187
1132517493_1132517499 -7 Left 1132517493 16:372598-372620 CCCGGCTCCTTACCCACATGGAG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1132517499 16:372614-372636 CATGGAGGCCATGATCACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1132517493_1132517503 6 Left 1132517493 16:372598-372620 CCCGGCTCCTTACCCACATGGAG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1132517503 16:372627-372649 ATCACGAAGGCAAAGAGGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 172
1132517493_1132517501 1 Left 1132517493 16:372598-372620 CCCGGCTCCTTACCCACATGGAG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1132517501 16:372622-372644 CCATGATCACGAAGGCAAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132517493 Original CRISPR CTCCATGTGGGTAAGGAGCC GGG (reversed) Exonic
902113749 1:14104233-14104255 CTCCTTGCGGGGAAGGAGCAGGG - Intergenic
903138478 1:21324583-21324605 CTTCATGTGGGAAAGGGGCGGGG - Intronic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
905114903 1:35629975-35629997 CTCCATGTTGGTCAGGTGTCAGG - Intronic
906197481 1:43937818-43937840 CTCCATGTGGATAAGGAGGCAGG + Intergenic
907659258 1:56376953-56376975 CTCCAGGTAGGAAAGGAGTCTGG - Intergenic
908441854 1:64163043-64163065 CTCCAGGCAGGTGAGGAGCCAGG - Intronic
912688036 1:111782311-111782333 CTAAATGTGGGGAAGGGGCCAGG + Intronic
913597612 1:120393796-120393818 CACCATGTGGTGAGGGAGCCTGG + Intergenic
914089718 1:144485518-144485540 CACCATGTGGTGAGGGAGCCTGG - Intergenic
914308892 1:146448698-146448720 CACCATGTGGTGAGGGAGCCTGG + Intergenic
914512435 1:148345792-148345814 CACCATGTGGTGAGGGAGCCTGG - Intergenic
914593217 1:149124433-149124455 CACCATGTGGTGAGGGAGCCTGG - Intergenic
914764156 1:150623149-150623171 TTCCAGGTGGGTAAGCTGCCTGG + Intronic
916564469 1:165961438-165961460 CTCCATGAGGGGCAGGAACCAGG - Intergenic
917591725 1:176483038-176483060 CTCCATGTGGCTGAAGAGCATGG + Intronic
919384004 1:196896616-196896638 TGCCATGTGGCTAAGGAGCGTGG + Intronic
919786402 1:201261078-201261100 ATCCAGGAAGGTAAGGAGCCAGG + Intergenic
920186398 1:204161959-204161981 GTCCATGAGGGAAAGGAGACAGG + Intronic
920411316 1:205763264-205763286 CTCCATCTGGGTGGGGAGGCGGG - Intergenic
920864610 1:209741474-209741496 CTCCAGGTGCCCAAGGAGCCAGG - Intergenic
922332844 1:224592862-224592884 CTCCAGGTGTGGAAGGAGCCAGG + Intronic
924281218 1:242439229-242439251 TTGCATGTGGGGAAGGAGCCGGG + Intronic
1065766197 10:29032062-29032084 CACTATGTGGGGAAGGAGACCGG + Intergenic
1070820282 10:79350326-79350348 CTTCCTGTGGGTCAGGACCCAGG + Intronic
1071569698 10:86690242-86690264 CTCCCAGTGGGTCAGGAGCCAGG + Intronic
1071785479 10:88895064-88895086 AGCCATGTGAGCAAGGAGCCAGG + Intronic
1071803658 10:89092920-89092942 CTCCATGTCCGTAAAGAGGCAGG + Intergenic
1072219760 10:93317254-93317276 TTACATGGGGGTAAGGAGACTGG + Intronic
1072475126 10:95752457-95752479 CTCCATGTTGGTCAGGCGGCTGG - Intronic
1073072189 10:100801690-100801712 CTCCATTTGGGGAGGGTGCCAGG + Intronic
1073151098 10:101312067-101312089 CACCATGGAGGTTAGGAGCCTGG + Intergenic
1073456964 10:103643193-103643215 TTCCAACTGGGAAAGGAGCCTGG - Intronic
1075845194 10:125539669-125539691 CTCCAGGTGGGTAATGGGCCTGG + Intergenic
1078617958 11:12882407-12882429 CGCCTTGTGGGGAAGGAGACAGG - Intronic
1084472459 11:69371087-69371109 TTCCATGTGAGTGAGGAGCCGGG + Intergenic
1086220540 11:84437797-84437819 CTCCATGTGTGTCAGGAGGAAGG + Intronic
1087650623 11:100862833-100862855 CTCCATGTTGGTCAGAAGGCTGG - Intronic
1087772602 11:102227004-102227026 CTCCAGGTGGGCGAGGAGACAGG - Intronic
1090177662 11:124665485-124665507 CTCCAGGTGGGAACGCAGCCTGG + Intronic
1091127913 11:133118478-133118500 CTCCATTTGGTCAAGGAGACAGG + Intronic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092099205 12:5869373-5869395 CTCCATGGGGACAAGGATCCAGG + Intronic
1096473934 12:51896574-51896596 CTCCCTGTGGGAAAGGAGAGAGG - Intergenic
1098416103 12:70237152-70237174 CTCCCTGGAGGTGAGGAGCCAGG - Intergenic
1100512238 12:95286941-95286963 ATCCAAGTGGGGAGGGAGCCAGG + Intronic
1102963945 12:117112041-117112063 CTGCATGAAGGTAAGAAGCCAGG - Intergenic
1103189759 12:118991261-118991283 CTCCATGGCAGGAAGGAGCCTGG - Intronic
1103920557 12:124397077-124397099 CTGTTTGTGGGCAAGGAGCCAGG - Intronic
1104789672 12:131473620-131473642 CTATATCTGGGTGAGGAGCCCGG - Intergenic
1108240017 13:48454532-48454554 CTCTATGAGGGGAAGGACCCAGG - Intronic
1112163616 13:96894712-96894734 CTCCATTAGGCTAAGGAGCAGGG + Intergenic
1113121540 13:106928940-106928962 CTCCAGGTGGAAAAGGAGACAGG - Intergenic
1113662652 13:112117845-112117867 CTCCATCTGGGTTTGGTGCCAGG - Intergenic
1113929414 13:113958422-113958444 CTCCAGGTGGGGACGGAGGCAGG - Intergenic
1114193595 14:20458803-20458825 CTACATGTGGATAAGGAACAAGG - Intronic
1114613138 14:24055020-24055042 TTCCATGAGGGTAAGGAGATGGG - Intronic
1117406784 14:55411793-55411815 CTCCCAGTGGGAAGGGAGCCCGG - Exonic
1118761902 14:68885246-68885268 CTCCTGGTGGGGAAGGAGCCCGG - Intronic
1118808508 14:69257795-69257817 CTCCATGGGGGGAAGGAGGGAGG - Intergenic
1122856470 14:104562618-104562640 CTCCATGTGGGCTAGGATCCGGG + Intronic
1123931475 15:25173695-25173717 CTCCATGCGGGAAAGGAGGCAGG - Intergenic
1123947753 15:25247098-25247120 CTCCATGTAGGGAAGGAGGTAGG - Intergenic
1128108202 15:65059550-65059572 CTCCATGTGGGTGAGAACCAAGG - Intronic
1128443076 15:67731585-67731607 CCCTATGTGGGAAAGGTGCCAGG - Intronic
1128788052 15:70412773-70412795 CTCCTTATGGGAAAGGGGCCAGG - Intergenic
1130991792 15:88880008-88880030 CTCCGTGTGGCCAAGGACCCAGG + Intronic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1133229862 16:4361348-4361370 CTCGCTGTGGGTAAGGAGGCTGG - Exonic
1133404843 16:5515243-5515265 CTCCATGTGGGCAAGTGGTCTGG + Intergenic
1137405363 16:48184808-48184830 CTCAATCTGGGTTAGGAGTCAGG - Intronic
1139339944 16:66261990-66262012 CTCCATCTGGGCTGGGAGCCTGG + Intergenic
1140209578 16:72959858-72959880 CTCCATGTAGGTCTGGAGGCTGG + Exonic
1141444767 16:84050766-84050788 CCCCATGTGGGTAAGGAGAGCGG + Intergenic
1141444820 16:84051021-84051043 CCGCATGTGGGTAAGGAGAGCGG + Intergenic
1141444888 16:84051390-84051412 CCGCATGTGGGTAAGGAGAGCGG + Intergenic
1141444929 16:84051618-84051640 CCACATGTGGGTAAGGAGAGTGG + Intergenic
1141444968 16:84051817-84051839 CCGCATGTGGGTAAGGAGAGCGG + Intergenic
1141444997 16:84051988-84052010 CCGCATGTGGGTAAGGAGAGCGG + Intergenic
1141445036 16:84052185-84052207 CCCCATGTGGGTAAGGAGAGCGG + Intergenic
1141770164 16:86085135-86085157 ATCCATGTGGGTGAAGTGCCTGG + Intergenic
1142218099 16:88839695-88839717 CACCATGTGCGGGAGGAGCCTGG + Intronic
1143217808 17:5238318-5238340 CTCCATGTTGGTTAGGTGGCTGG + Intergenic
1144157037 17:12514587-12514609 CTCCATGTGGGAATTGAGTCTGG + Intergenic
1146109535 17:30075666-30075688 GTCCATGTGGGTAAAGACGCTGG - Intronic
1146489848 17:33272963-33272985 CTCCAGGTGGAAAAGGAGGCTGG - Intronic
1147266175 17:39236377-39236399 CTCCAGGTTGGAAAGGTGCCTGG + Intergenic
1148777442 17:50103626-50103648 CTCCAAGTGCTTAAAGAGCCAGG + Intronic
1149684750 17:58528915-58528937 CTCCATGCGGATGAGCAGCCAGG - Intronic
1150631892 17:66885620-66885642 CTGCATCTGTGTAAGGAGCTTGG - Intergenic
1151388610 17:73770692-73770714 CACCAGGAGGGCAAGGAGCCAGG + Intergenic
1151765891 17:76132914-76132936 CTCCATCTGGGGCAGGAGTCAGG - Intergenic
1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG + Intergenic
1152680676 17:81666397-81666419 CCGCATGTGGGGACGGAGCCGGG - Exonic
1153256650 18:3178394-3178416 CATCATGTGGGTCAGCAGCCAGG - Intronic
1153706253 18:7748568-7748590 TTTCATGTGTGTAAGTAGCCCGG - Intronic
1157285790 18:46376337-46376359 TTCCGTGTGGTTAAGGAGCATGG + Intronic
1157443200 18:47725724-47725746 GTCCATGTGTATAAGGAGGCTGG - Intergenic
1159676436 18:71288856-71288878 CTCAATGTGGGAATGCAGCCTGG + Intergenic
1159914120 18:74173548-74173570 CTCCATGAGGAAAAGGAGGCAGG - Intergenic
1160603164 18:80029914-80029936 CTCCATGAAGATAAGGTGCCTGG + Intronic
1161458173 19:4380382-4380404 CTCCTTGCGGGGAGGGAGCCAGG + Intronic
1163011447 19:14429089-14429111 CTCCATCTGGGGAGGCAGCCTGG + Intergenic
1163512131 19:17741614-17741636 CTAAAGGTGGGAAAGGAGCCTGG + Intergenic
1164628699 19:29746799-29746821 CTCCAGGTGGTATAGGAGCCCGG - Intergenic
1165434663 19:35789372-35789394 CTCCCTGTGGGTCAGCAGGCTGG + Intergenic
1166939809 19:46355813-46355835 CTCCAGGTGGGAAGGGGGCCTGG + Intronic
1167114891 19:47483450-47483472 CACCATGTGTGTAAGGAGGAGGG + Intronic
1167671741 19:50857436-50857458 TTCCAAGTGGGTAGGTAGCCTGG - Intronic
1168356594 19:55704042-55704064 CTCCGTGTGGGCGAGAAGCCTGG - Intronic
1168700270 19:58434554-58434576 CCCCATGTGTGTAAGGAGTGTGG - Exonic
925402413 2:3585173-3585195 GTCCATGTGGGTCAGGCACCAGG + Intergenic
926325025 2:11778113-11778135 GTCCATGTGGGAAAGGCTCCTGG - Intronic
927149494 2:20187541-20187563 CACCATGTGGGGAGGGAGGCCGG - Intergenic
927706387 2:25298982-25299004 CTCCCTTTGGGTAGAGAGCCGGG - Intronic
927985721 2:27409290-27409312 CTCCATGGAGGTGAGGAGGCAGG - Exonic
928212609 2:29334712-29334734 CTCCATTCGGGGAAGGAGACTGG - Intronic
932143360 2:69298408-69298430 CTCCATGTGGCTTAGGAGCCTGG + Intergenic
934735200 2:96686447-96686469 TTCCATGTGGTTAAGGGACCAGG - Intergenic
937223305 2:120354122-120354144 CTCCAGGTGAGTCAGGAGCCCGG - Intergenic
938310072 2:130284022-130284044 CTCCATGTGGCTAATGGGCTTGG + Intergenic
938444847 2:131368347-131368369 CTCCATGTGGCTAATGGGCTTGG - Intergenic
939724232 2:145695369-145695391 TTCCATGTGGATAAATAGCCAGG + Intergenic
941447929 2:165625273-165625295 CAACATTTGGGTAAGGAGACAGG + Intronic
942075212 2:172351272-172351294 CTGCCTGTGGATAATGAGCCAGG + Intergenic
944316390 2:198289988-198290010 CTCCATGGGGTTTAGCAGCCTGG + Intronic
944446386 2:199794938-199794960 CTTCAAGAGGGTAAGGTGCCTGG - Intronic
946411151 2:219515753-219515775 CTCCATCTAGGGAAGGACCCCGG + Intronic
948719016 2:239884344-239884366 TTCCATGTGGGGACAGAGCCTGG + Intergenic
1170274856 20:14574123-14574145 CTCCATGGTGGTCAGGTGCCAGG + Intronic
1171197611 20:23212630-23212652 CTCCTGGTGTGGAAGGAGCCAGG - Intergenic
1172764025 20:37341562-37341584 CCCCATGGGAGTCAGGAGCCAGG - Intergenic
1174619382 20:51862546-51862568 CTCCATGTTGGTCAGGGGTCAGG - Intergenic
1175453845 20:59094823-59094845 CTCAATGAGAGTAAGGAGGCGGG - Intergenic
1175550474 20:59814128-59814150 CTCCCTGGGGGTCAGGAGCGAGG + Intronic
1176076839 20:63252503-63252525 CTGCATGGGGGTAGGGGGCCCGG - Intronic
1184100929 22:42341471-42341493 ATCCAGGTGGGTAAGGACCTGGG + Intronic
1185369648 22:50455148-50455170 CGCCATGTGGGTCAGGGGCCAGG + Intronic
950424916 3:12919914-12919936 CTCCCTGAGGGCAGGGAGCCGGG + Intronic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
952906646 3:38143578-38143600 ATCCAGGTGGCTCAGGAGCCAGG - Intergenic
954305404 3:49722959-49722981 CTCCATCCTGGTAAGGCGCCAGG - Exonic
954930984 3:54281098-54281120 CTCCAGGTTGTTTAGGAGCCAGG - Intronic
955551306 3:60088037-60088059 CACCATGAGTGTAAGCAGCCAGG - Intronic
960447978 3:117771139-117771161 CTCAGTGTGGTTCAGGAGCCTGG + Intergenic
961489599 3:127245359-127245381 CTCCATGTGGGTGGTGTGCCTGG - Intergenic
968944277 4:3655379-3655401 CCCCAGCTGGATAAGGAGCCCGG + Intergenic
969808802 4:9632036-9632058 TTTCCTGTGGGTCAGGAGCCTGG + Intergenic
971510855 4:27421624-27421646 CTCCAGGGGGGTGAGGAGCAAGG - Intergenic
971981447 4:33756357-33756379 CTCTATGAGGGTAAGAAGCCTGG + Intergenic
974102001 4:57427440-57427462 CTTCATGTAAGGAAGGAGCCAGG - Intergenic
975389443 4:73799679-73799701 CTCTATGTGGGGAAGGAGAGTGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978250277 4:106622555-106622577 CTCCATGTGGGTGATGTGCATGG - Intergenic
986207930 5:5643787-5643809 CTCCGAGTGGGTCAGGAGGCTGG - Intergenic
987092712 5:14522134-14522156 CTCCTTGGGGGTGAGGAGTCAGG - Intronic
990329001 5:54706955-54706977 CCCCAAGTGGGTGAGGGGCCTGG - Intergenic
999519245 5:152333526-152333548 CTCCATGTGGTACAGGAGGCTGG + Intergenic
999600990 5:153265086-153265108 CTCCATGGGGGCAAGCTGCCTGG + Intergenic
1003195413 6:3909839-3909861 CTCAATGTGGCTCAGGAGCGAGG - Intergenic
1004851090 6:19699823-19699845 CTCCAGGTGGGGAGGTAGCCAGG - Intergenic
1006954157 6:37852197-37852219 CTCCATGGGGGTGAGGAGGATGG + Intronic
1007400463 6:41599786-41599808 CTGGATGTGGGTGTGGAGCCGGG - Exonic
1007966919 6:46011878-46011900 CTGCAAGTGAGGAAGGAGCCAGG + Intronic
1011377076 6:86700319-86700341 CTCCTTATGGGTATGAAGCCAGG - Intergenic
1013261932 6:108452755-108452777 CTCCATGGGACTAAGGAGCAAGG - Intronic
1014125073 6:117768177-117768199 GCCCAAGTGGGTAAGGAGCAGGG - Intergenic
1019206349 6:170365145-170365167 TTCCATGTGGGTAAAGTGCCAGG - Intronic
1019506170 7:1392657-1392679 TTCCAGGTGGGGATGGAGCCGGG + Intergenic
1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG + Intergenic
1025759593 7:64377637-64377659 CTCCATGTGGGTAGGGTCCAAGG - Intergenic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1027768506 7:82376628-82376650 ATTCATGTGGGTTAGAAGCCTGG + Intronic
1032222796 7:130007203-130007225 CTCCAGGTGGGAAAGGTGGCTGG - Intergenic
1032401043 7:131624610-131624632 CACTAGGTGGGTAAGGACCCTGG - Intergenic
1034192379 7:149222278-149222300 GTCCAGGTGGGTCAGGTGCCAGG + Intronic
1035043772 7:155950884-155950906 GTCCTTGTGGGGAAGGAGCTGGG + Intergenic
1040378652 8:46850971-46850993 CTCCATGTGGGTAGGGCCCAAGG - Intergenic
1040866813 8:52055838-52055860 CTCCAGGGGGGTGAGGTGCCAGG - Intergenic
1040901891 8:52426172-52426194 GTTCATGTGTGTAAGGAACCTGG + Intronic
1041840631 8:62266600-62266622 CTCCATCTGAGTCAGGAGGCGGG + Intronic
1047519357 8:125582661-125582683 CTCCTTGTGGCTAAGGGGCTGGG + Intergenic
1047531246 8:125678779-125678801 GTCGATGTGAGTTAGGAGCCAGG + Intergenic
1047975108 8:130122057-130122079 CTCCCTGGGGGGAAGCAGCCAGG - Intronic
1049218039 8:141416747-141416769 CTCCAGGTGGGCAAGCAGGCTGG - Intronic
1050135591 9:2460045-2460067 ATAAATGTGGGTAAGAAGCCTGG - Intergenic
1056763246 9:89429093-89429115 CTGCATTTGGGGAAGGAGCTGGG - Intronic
1059867535 9:118532949-118532971 GGGCATGTGGGTAAGGTGCCTGG + Intergenic
1059978523 9:119743954-119743976 CTCAATGTGGGTAAGGATAAAGG - Intergenic
1061659866 9:132122175-132122197 TTCGAGGTGGGTGAGGAGCCAGG + Intergenic
1062079860 9:134618114-134618136 CTCCCTGGGGGAAAGGAGGCTGG - Intergenic
1062212052 9:135370455-135370477 CTCCATGTGGGGAAGGCCCAGGG + Intergenic
1186169532 X:6862069-6862091 CTCCATCTGTGGAAGGTGCCTGG - Intergenic
1188532892 X:31162141-31162163 CTCCATGAGGGTAAGAACCAAGG + Intronic
1190003822 X:46715136-46715158 ATCAATGTGAGTAAGGAGCTTGG - Intronic
1197697588 X:129567421-129567443 CTCCATATTGGTAAGGGGCTAGG + Intronic
1197781245 X:130162662-130162684 CTCCTTGTGGGCAAGGATCCTGG - Intronic
1199582845 X:149377674-149377696 TTCCAAGTGTGTAAGGAGCCTGG - Intergenic
1200234100 X:154459952-154459974 CCCCATGCTGGAAAGGAGCCAGG - Intronic
1200897649 Y:8392711-8392733 CATCATCTGGGTAATGAGCCAGG + Intergenic
1202268350 Y:23044470-23044492 CTCCATGTGGGTAGGGTCCAAGG - Intergenic
1202421342 Y:24678214-24678236 CTCCATGTGGGTAGGGTCCAAGG - Intergenic
1202449444 Y:24991868-24991890 CTCCATGTGGGTAGGGTCCAAGG + Intergenic